ID: 901303869

View in Genome Browser
Species Human (GRCh38)
Location 1:8218316-8218338
Sequence TCCTCCCCAGGCTACCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901303869_901303880 24 Left 901303869 1:8218316-8218338 CCCCACAGGTAGCCTGGGGAGGA 0: 1
1: 0
2: 1
3: 24
4: 242
Right 901303880 1:8218363-8218385 TGATGGAGAGGCTTTTGCTTAGG 0: 1
1: 0
2: 2
3: 28
4: 204
901303869_901303878 12 Left 901303869 1:8218316-8218338 CCCCACAGGTAGCCTGGGGAGGA 0: 1
1: 0
2: 1
3: 24
4: 242
Right 901303878 1:8218351-8218373 GATGCTTTTCCATGATGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 309
901303869_901303877 7 Left 901303869 1:8218316-8218338 CCCCACAGGTAGCCTGGGGAGGA 0: 1
1: 0
2: 1
3: 24
4: 242
Right 901303877 1:8218346-8218368 TGGTGGATGCTTTTCCATGATGG 0: 1
1: 0
2: 0
3: 18
4: 169
901303869_901303875 -10 Left 901303869 1:8218316-8218338 CCCCACAGGTAGCCTGGGGAGGA 0: 1
1: 0
2: 1
3: 24
4: 242
Right 901303875 1:8218329-8218351 CTGGGGAGGACCGTGGCTGGTGG 0: 1
1: 0
2: 6
3: 44
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901303869 Original CRISPR TCCTCCCCAGGCTACCTGTG GGG (reversed) Intergenic
900410305 1:2509677-2509699 CCCTCCCCAGGCCACCTTCGGGG + Intronic
900506512 1:3032131-3032153 TCCTCCCCAGGGTGCCCGGGTGG - Intergenic
901303869 1:8218316-8218338 TCCTCCCCAGGCTACCTGTGGGG - Intergenic
901715469 1:11150093-11150115 TCCTTCACAGGGTGCCTGTGAGG + Intronic
901786870 1:11630377-11630399 TCCACCCCAGCCTACATGGGTGG - Intergenic
901848857 1:12002257-12002279 TCCTCACCAGGCTGTCTATGTGG - Intronic
902312540 1:15592614-15592636 GCCTCCCCAGGCTGCCTGGCTGG + Intergenic
902556788 1:17251447-17251469 TCATCCCCAGGCAACAGGTGAGG - Intronic
902803771 1:18848200-18848222 TCCACCACAGACTAGCTGTGTGG + Intronic
904069872 1:27786311-27786333 TTCTCCCCAAGATAGCTGTGTGG + Intronic
905358081 1:37398821-37398843 TCCTGCCCAGTCCCCCTGTGTGG - Intergenic
905935320 1:41818815-41818837 CCCTCCCCACGCTTCCTGAGTGG + Intronic
911569155 1:99501830-99501852 TCCACCCCATACTAGCTGTGTGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915060081 1:153174414-153174436 TCCTCACCAGGCTAGTTTTGTGG - Intergenic
915997441 1:160577622-160577644 TCCTGCCCAGGATCTCTGTGTGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
924563132 1:245173649-245173671 TGCTCCCCGGCCTCCCTGTGAGG + Intronic
1063413765 10:5856814-5856836 TCCTTCCCAGGTTTACTGTGAGG - Intergenic
1064458562 10:15511130-15511152 TCCTCTACAGGTAACCTGTGAGG + Intergenic
1065588862 10:27245964-27245986 TCCTCCGCCGGCTGCCTCTGTGG + Intergenic
1065879722 10:30028218-30028240 TCCCACCCATGCTTCCTGTGAGG + Exonic
1067360295 10:45572773-45572795 TCCTCCCCAGGCTGCTTTTCTGG + Intronic
1069063345 10:63916785-63916807 TCCACCCCATGCTACCAGGGTGG - Intergenic
1071716661 10:88103873-88103895 TGCTCCCCAGGGTTCATGTGAGG + Intergenic
1072274008 10:93804435-93804457 GCCTACCCAGGTTACCAGTGGGG - Intergenic
1072847880 10:98852467-98852489 TGCACCCCTGGCTACCTGGGAGG - Intronic
1072928568 10:99639661-99639683 TCCGCCCCAGGCTACCTTCTTGG + Intergenic
1075710957 10:124530277-124530299 TCCTCCCCACGCCACCTGCTCGG + Intronic
1076577431 10:131478972-131478994 TCCTCCCCAGGATCACTGGGTGG - Intergenic
1078450808 11:11439318-11439340 TCCTCCAGAGCCTGCCTGTGTGG + Intronic
1079504435 11:21137629-21137651 TCCTCCTCAGGCCAACTGTTAGG + Intronic
1079631485 11:22683025-22683047 TTCTGCACAGGCTACCTGTGTGG + Intronic
1080187283 11:29505000-29505022 TCCTCCTCTTACTACCTGTGAGG + Intergenic
1080209964 11:29774328-29774350 CACTCCCCAGTCTACATGTGTGG + Intergenic
1081965291 11:47165591-47165613 GCCTCCCCAGTCTTGCTGTGGGG - Intronic
1081969505 11:47187803-47187825 GCCTCCCCAAGACACCTGTGGGG + Intergenic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1083914034 11:65728333-65728355 TCCTCCACAGCCCACTTGTGTGG + Intergenic
1086097280 11:83063123-83063145 TCTTCCCCAGGGTTCCTGTTAGG + Intronic
1086948184 11:92865041-92865063 TTCTCTCCAGGGTACCTGAGTGG + Intronic
1088937708 11:114420263-114420285 TCTTCCCCAGGCTACTTTTGGGG + Intronic
1089452911 11:118609773-118609795 TCCTGCCCAGGCTGCCCGCGTGG - Intronic
1091303004 11:134519574-134519596 TCCTGCCCAGGACCCCTGTGTGG - Intergenic
1091833251 12:3565485-3565507 TCCTCACCAAGCCAACTGTGGGG + Intronic
1092169009 12:6361809-6361831 TCTTCCCAAGGCATCCTGTGAGG + Intronic
1092362813 12:7851774-7851796 TCATTCTCAGGCTACCTGAGAGG - Intronic
1092379358 12:7982441-7982463 TCATTCTCAGGCTACCTGAGAGG - Intergenic
1092412053 12:8261094-8261116 TCCTTTCCAGGCAGCCTGTGTGG - Intergenic
1092492143 12:8955497-8955519 TACTCCACAGGCTAGCTGGGAGG - Intronic
1094702326 12:32881873-32881895 TCCTCCCCAGGCCACTAGGGAGG + Intronic
1097084316 12:56455870-56455892 TCCTACCCAGTACACCTGTGGGG + Intronic
1098094201 12:66937141-66937163 TCCTCCCCGAGATACCTGAGTGG + Intergenic
1098450552 12:70613479-70613501 TCCTCCCCAGGCTCTCTGTTTGG + Intronic
1101881632 12:108629780-108629802 TCCTCCCCCTTCTACCTGTGTGG - Intronic
1102493756 12:113305202-113305224 TCCTTCCCAGCCAACCTGGGAGG + Intronic
1102780612 12:115561439-115561461 TCCTCCCTGGGCTGGCTGTGTGG - Intergenic
1103783022 12:123412125-123412147 TGCTCCCCTGCCTCCCTGTGGGG - Exonic
1104384999 12:128342866-128342888 ACCTGCCCTGGCTGCCTGTGCGG + Intronic
1105280135 13:18958501-18958523 TCCCCACCAGGCTAGCAGTGAGG - Intergenic
1105707556 13:22977492-22977514 TCCTCACCATGGTTCCTGTGGGG + Intergenic
1107095388 13:36530027-36530049 TCCTGGCCAGGCTTTCTGTGTGG - Intergenic
1110493303 13:76135087-76135109 CCCTCCCCAGGCAACCTGGTTGG - Intergenic
1113910513 13:113839164-113839186 GCCCTCCCAGGCCACCTGTGGGG + Intronic
1115537228 14:34384662-34384684 TCCTCCCCAGGCTGAGGGTGTGG + Intronic
1118373157 14:65154671-65154693 TCTACCCCAGCCTACCTGGGAGG - Intergenic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1119472004 14:74906241-74906263 TCCTCCCCAGTGGGCCTGTGTGG - Exonic
1119582856 14:75803147-75803169 TCCTCTTCAAGCTACCTGAGTGG - Intronic
1119653049 14:76397219-76397241 ACCTCCAGAGGCTGCCTGTGGGG + Intronic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1121974137 14:98386790-98386812 TCTTCCCCAGGGTACCTAGGAGG + Intergenic
1123945346 15:25236301-25236323 TGCAGCCCAGGCTCCCTGTGTGG + Intergenic
1124204223 15:27703569-27703591 TCCTCCCCAGGCTTCCAGGTAGG - Intergenic
1124459468 15:29875890-29875912 TTGTCACCAGGCTCCCTGTGAGG + Intronic
1124858883 15:33418533-33418555 TCCTCCTCTTGCTACCTGTCTGG - Intronic
1125542898 15:40481207-40481229 TCCTCCACAGGGTTCCTCTGGGG + Intergenic
1125686904 15:41568833-41568855 TTCTCCCCAGGCTCACTATGGGG + Intronic
1125736904 15:41933290-41933312 TCCTCCCCAGGATACACGTGTGG - Intronic
1127692635 15:61412925-61412947 TCCTGCCCAGTCTTCCTGTAGGG + Intergenic
1127711019 15:61598444-61598466 TCCTCCCCAGGCCCTCTATGTGG + Intergenic
1128087691 15:64897296-64897318 TCCTCCCATGGCATCCTGTGTGG - Intronic
1128309374 15:66620921-66620943 TCCTTCCCAGGGCAGCTGTGGGG - Intronic
1130886118 15:88094061-88094083 TCCTCCCCAAGCACACTGTGTGG + Intronic
1132812940 16:1810431-1810453 TCCTCCCCGTGCTTGCTGTGAGG - Intronic
1134110860 16:11514657-11514679 TCCTCCCCAGCCTCGCTGAGTGG - Intronic
1139895439 16:70284647-70284669 TTCTCCCCAGCCTACCTCTCAGG - Intronic
1141420823 16:83914391-83914413 TCCTCCCATGGCCACCTGTGAGG - Intronic
1141515229 16:84539698-84539720 TCCTCCCGAGTCTCCCTGGGGGG - Intronic
1141620924 16:85236082-85236104 TCCCTCCCTGGCTGCCTGTGTGG + Intergenic
1141770035 16:86084368-86084390 TCCTCCCCATGCTACGGATGAGG + Intergenic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1144783785 17:17820797-17820819 TCAGCCCCAGCCTAGCTGTGGGG - Intronic
1146693635 17:34893063-34893085 TCCTCCTCAGGCTGCCTGTTGGG - Intergenic
1148084560 17:44986145-44986167 TCCCCCTGTGGCTACCTGTGAGG + Intergenic
1150433383 17:65136726-65136748 TCCTCACCGGGCTAGCTGTCTGG - Intergenic
1151112421 17:71694480-71694502 TCCTCCACTGGCCACTTGTGAGG - Intergenic
1151433158 17:74078607-74078629 TCTTCCCAAGGCTGCCTCTGTGG + Intergenic
1153724153 18:7937875-7937897 TCTTCCCCAGCCTTCCAGTGGGG + Intronic
1154391340 18:13938978-13939000 CCCTTGCCAGCCTACCTGTGTGG - Intergenic
1156362844 18:36399587-36399609 TCCACCCCAGGCTGCCCTTGGGG + Intronic
1157140622 18:45102444-45102466 TGCTTTCCAAGCTACCTGTGAGG - Intergenic
1160774987 19:851217-851239 TCCTTCCCAGGGTTCCTGTTTGG - Intronic
1160871490 19:1279825-1279847 TCCCCCACAGGCAACCTGTCTGG + Intergenic
1161425880 19:4202859-4202881 CCATCCCCAGGCTTCCTGCGTGG + Exonic
1164925137 19:32124464-32124486 TCCTAACCAAGCTGCCTGTGGGG + Intergenic
1165225432 19:34351452-34351474 TCCTGCCCAGCCCACCTGTAGGG - Intronic
1165341290 19:35214110-35214132 TCTTGCCCAGGCTTCCTGTCAGG + Intergenic
1166676968 19:44746740-44746762 TCCTTCCCACCCTACCTCTGAGG + Intergenic
1166755429 19:45187747-45187769 TCCTCACTTGGGTACCTGTGGGG + Intronic
1167548569 19:50143988-50144010 TCTTCCCCAGGATAACTTTGTGG - Intergenic
1167763121 19:51461843-51461865 TTACCCCCAGGCTTCCTGTGGGG - Intergenic
924960431 2:29721-29743 ACCACCACAGGCTCCCTGTGTGG - Intergenic
925640951 2:5985438-5985460 TCCTCTCCAGCCTGCCTGTGTGG - Intergenic
926082828 2:10002828-10002850 GGGTCCCCAGGCTTCCTGTGTGG - Intergenic
929213785 2:39388605-39388627 TTTTCCCCAACCTACCTGTGCGG - Intronic
930690257 2:54355453-54355475 TCCTGCCCCTGCTACCTGTTTGG + Intronic
931697061 2:64879309-64879331 CCCTATCCAGTCTACCTGTGAGG + Intergenic
934021318 2:87956675-87956697 TCCTGCCCATGCTTCCTGGGAGG - Intergenic
935076836 2:99753647-99753669 CCCTCCCACGGCTTCCTGTGTGG - Intronic
936985927 2:118311234-118311256 TCCTTCCCAGGCCTCCTGGGCGG - Intergenic
939376577 2:141375950-141375972 TCCTTCCCAGGCAAGCAGTGTGG + Intronic
941920839 2:170849278-170849300 ACCTCCCCAGGCAGCCTGTGGGG - Exonic
942754400 2:179322370-179322392 TGCTTCCCAGGCTACATGTTAGG - Intergenic
943718570 2:191179129-191179151 TCTTCTTCAGGCTCCCTGTGAGG - Intergenic
944134905 2:196388485-196388507 TCATTCCCATGTTACCTGTGGGG + Intronic
945435259 2:209810282-209810304 TCCTCCCAGGCCTACCTGTTGGG - Intronic
946027678 2:216681662-216681684 TCCTCCTCTGGCTACCTGTTGGG + Intronic
946482789 2:220073138-220073160 TCCTCTCCAGCCCACCAGTGTGG - Intergenic
947357711 2:229314384-229314406 TCATTCCAAGGCTTCCTGTGTGG + Intergenic
947805017 2:232960472-232960494 CCCTTTCCAGGCTGCCTGTGAGG - Intronic
947884881 2:233560581-233560603 TACTTCTCAGGCTACCTGTGTGG - Intronic
948143586 2:235692302-235692324 TCTTCCCCAGGGTGCCAGTGGGG + Intronic
948981522 2:241497143-241497165 CCCTCCCCAGGCTCCAGGTGGGG + Intronic
1168970522 20:1927685-1927707 TCCTTCCCAGGCTTCCTTGGTGG + Intronic
1169107028 20:3005070-3005092 TCCTATCCAGGCCACCTGTGAGG + Exonic
1169499744 20:6147979-6148001 ACCTCCCCAGGATCCCTGTCAGG - Intergenic
1171027458 20:21643925-21643947 GCTTCCTCAGGCTACCTGAGAGG + Intergenic
1172167149 20:32906442-32906464 TCCTCCCTAGGCCTCCTGGGAGG + Intronic
1173475397 20:43355658-43355680 TGCTCCCCAGGTCAGCTGTGAGG - Intergenic
1173866047 20:46313187-46313209 TCGTCCCCATGCTACCGCTGGGG + Intergenic
1174275469 20:49400615-49400637 TCCTGGCCTGGCTTCCTGTGGGG - Intronic
1174941218 20:54930731-54930753 TTTTCCCCAGCCTCCCTGTGTGG + Intergenic
1175382469 20:58573229-58573251 TCCTCCCCAGGAGAACTGTCAGG + Intergenic
1175526347 20:59637067-59637089 TGCTCCTCAGGCTCCCTGTGGGG + Intronic
1180835107 22:18925859-18925881 TCCACCCCAGGCTAGGGGTGGGG - Intronic
1180855428 22:19042034-19042056 TCCTGCCCAGGCGGGCTGTGTGG + Intronic
1181520300 22:23444620-23444642 TCCTTTGCAGGCTAGCTGTGTGG + Intergenic
1183361444 22:37385141-37385163 CCCTCCCCGGGCTACCTCTCAGG - Intronic
1183373476 22:37448849-37448871 TCCTCCCCTGCCCACCTGGGAGG - Intergenic
1183474197 22:38026875-38026897 TCCTACCCCGGCTGCCTCTGAGG + Intronic
1183498497 22:38163994-38164016 TCCTTCCCAGGATGCCTGGGAGG + Intronic
1183950104 22:41347980-41348002 TCCTTCCCCAGCTAGCTGTGTGG + Intronic
1184572783 22:45337128-45337150 TCCAGCCCAGGCTTCGTGTGGGG - Intronic
1185402203 22:50625089-50625111 TCCCCCACAGGCTCCCAGTGAGG + Exonic
1203285196 22_KI270734v1_random:151158-151180 TCCACCCCAGGCTAGGGGTGGGG - Intergenic
951579805 3:24150388-24150410 GCCTTCCCAGGGTACTTGTGCGG - Intronic
954864297 3:53715871-53715893 TGCTCCCTAGACTAACTGTGGGG - Intronic
955470191 3:59278711-59278733 TCCACAGCAGGCTACCTGAGGGG - Intergenic
955912863 3:63875532-63875554 TCCTCACCTGGCTATCTGTGGGG - Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
958270601 3:91494341-91494363 TCTTTCCCTGGCTACCTGTTAGG - Intergenic
963845098 3:150147465-150147487 TCCTCCCCAGGCAAAATGAGGGG + Intergenic
963970989 3:151429332-151429354 TGCTCACCAGGCTGCCTGTGTGG - Intronic
965863417 3:173174660-173174682 TCCTTCCCAGCCTTCCTATGCGG + Intergenic
967125326 3:186418428-186418450 TCCTCCCCAGGCCACCACTGTGG + Intergenic
967878199 3:194281001-194281023 TCCTCCCTGGGGTGCCTGTGTGG + Intergenic
969075876 4:4577257-4577279 TCCTCCCCATGCTAGGGGTGGGG + Intergenic
969325727 4:6442769-6442791 TCCTCACCTTGCTAGCTGTGTGG - Intronic
969514709 4:7640596-7640618 ATCACCCCAGGCTATCTGTGTGG - Intronic
971820932 4:31554238-31554260 TCCTCCCAAGGCAACCGTTGAGG + Intergenic
980734244 4:136863917-136863939 TCCTCACCAAGCTCCCTCTGTGG - Intergenic
981396651 4:144257722-144257744 TCTTGACCAGGCTACCTGAGAGG + Intergenic
982602423 4:157469120-157469142 TCTTGCCCAGGATACCTGAGGGG + Intergenic
984549091 4:181139479-181139501 TCCTCCCTACTCTACCTGTCAGG + Intergenic
985550514 5:531272-531294 TCCTCCTCCGGCTTCCTTTGAGG + Intergenic
986132997 5:4948103-4948125 TCATCCCCAGGCTGCTTATGTGG + Intergenic
986177793 5:5366640-5366662 TGCTCCCCAGGGCACGTGTGTGG - Intergenic
986559664 5:9047938-9047960 TCTTCCACAGGGTAACTGTGAGG + Intronic
988607380 5:32690455-32690477 TTCTCTCCAGTCTCCCTGTGCGG + Intronic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
990535699 5:56719789-56719811 TTCTCCCTTTGCTACCTGTGAGG - Intergenic
990754712 5:59056059-59056081 TCCTCCCCAGGAAGCCTGTCTGG - Intronic
991518006 5:67460950-67460972 TTGTCCCCATGCCACCTGTGTGG + Intergenic
991996197 5:72389557-72389579 TCCTCCCAAGGTAACCTGGGAGG - Intergenic
994383508 5:99099967-99099989 CCCACCCCAGGCTCACTGTGAGG - Intergenic
997350342 5:133226483-133226505 TCCTACCCAGCCTGGCTGTGGGG + Intronic
997677550 5:135724547-135724569 TCCTGTCCAGGGTTCCTGTGGGG - Intergenic
999743663 5:154575666-154575688 CCCTCCCCAGGCAGCCTGGGAGG - Intergenic
1000405853 5:160887746-160887768 TCTTCCCCAAGATACCTGTGTGG + Intergenic
1001306297 5:170576233-170576255 TCCTCCCCAGTCTCCTTGTTTGG + Intronic
1001399003 5:171435726-171435748 TCCATCCCAGGGTAGCTGTGAGG - Intronic
1001751419 5:174134364-174134386 TCCTCCCCAAGCATCCTGAGAGG - Intronic
1002214469 5:177620190-177620212 TCCTCCCCAGGAAACTTCTGAGG - Intergenic
1003048683 6:2761181-2761203 TCCTCCCCATTCTGACTGTGGGG + Intergenic
1003569580 6:7247214-7247236 GCCTGCCCTGGTTACCTGTGTGG - Exonic
1005958869 6:30682728-30682750 CCCACCCCAGGCTTCCTGTTTGG + Intronic
1006056651 6:31390134-31390156 TCCTACCCTGGGTGCCTGTGGGG + Intergenic
1006408455 6:33858326-33858348 CCCACCCCAGGCTACCACTGTGG - Intergenic
1006929843 6:37681003-37681025 TCCTGCCCAGGTTTCCTGGGGGG - Intronic
1007450771 6:41939464-41939486 TCCTCCCCAGGCTCCTTCTGAGG + Intronic
1007805741 6:44444507-44444529 TCCTGCTCAGGCTGCCTGAGGGG + Intronic
1008647616 6:53531059-53531081 TCCTCCCCAGCAGCCCTGTGAGG - Intronic
1011796746 6:90962442-90962464 TAATTCCCAGGCTACCAGTGAGG + Intergenic
1012387117 6:98695175-98695197 AACTTCCCAGGCTAGCTGTGGGG + Intergenic
1015232166 6:130927658-130927680 TCCTCCTCAAGATACATGTGTGG - Intronic
1017956223 6:159179923-159179945 TCCCTCCCAGCCTAACTGTGTGG + Intronic
1018982546 6:168611957-168611979 ACCTCCCCAGGGACCCTGTGAGG - Intronic
1019181192 6:170188121-170188143 TCCCTCCCAGGCTGGCTGTGAGG - Intergenic
1019328334 7:450684-450706 TGCTCGCCCCGCTACCTGTGTGG + Intergenic
1019590942 7:1831608-1831630 TCCTTTGCAGGCTAGCTGTGTGG - Intronic
1019648124 7:2141794-2141816 CCTTCCCCAGGCTGTCTGTGCGG - Intronic
1019711866 7:2521515-2521537 TCATCGCCAGGCAACCTGAGTGG - Intronic
1019965951 7:4498804-4498826 TCAGCCCCAGGCTACCTGAGTGG - Intergenic
1020117992 7:5487129-5487151 TCCAGCCCAGGGCACCTGTGTGG - Intronic
1020429311 7:8103459-8103481 TCTTCCACAGGCTATCAGTGTGG - Intergenic
1020530655 7:9329892-9329914 TCCTCCTCAGCCCACCAGTGAGG + Intergenic
1022736461 7:33080856-33080878 CCCTGCCCAGCCTACCTGTGAGG + Intergenic
1023059806 7:36316206-36316228 TCGTCCCCAGGCCACCTGGAAGG - Intergenic
1023209202 7:37784886-37784908 TTCTCCTCAGGCTACCTCTCTGG + Intronic
1023968525 7:44975940-44975962 TCCTCCCCAGGCTGCAGCTGAGG - Intronic
1024113648 7:46172376-46172398 TCCTCCCCAGGACACCTGCTAGG - Intergenic
1024568638 7:50705911-50705933 TGCTCCCCTGGCTATCTGAGAGG + Intronic
1026878452 7:73893443-73893465 GCGTCCCCAGGCGACTTGTGTGG + Intergenic
1033360965 7:140638864-140638886 TCCTGCCCAGCCTGGCTGTGAGG - Intronic
1033599317 7:142877363-142877385 TCCATCCCAGGCTACCCCTGAGG - Intronic
1033629371 7:143141654-143141676 GTCTCTCCAGGCTACCTGTGTGG - Intergenic
1034972989 7:155430772-155430794 CCCTCCACAGCCTTCCTGTGCGG - Intergenic
1035030939 7:155859246-155859268 TCCTCCTCATCCTAGCTGTGTGG - Intergenic
1035076428 7:156180666-156180688 TCCTCTGCAGGCTGCCTCTGCGG - Intergenic
1035422667 7:158742350-158742372 TCCTCCCCAGGCCACGTCTCAGG + Intronic
1035972294 8:4262629-4262651 TCAGCCCCAGGCTAACTGGGTGG - Intronic
1036728857 8:11243995-11244017 TCCTCCCCAGGCTGCCTCGTGGG - Intergenic
1036782596 8:11659722-11659744 TTCTCCCCAGGGCACCTTTGGGG + Intergenic
1037397200 8:18455780-18455802 TCCTCCTCATGCCACCTGGGAGG - Intergenic
1039376938 8:37044281-37044303 TCCTGCCCAGCCTCCCTTTGGGG + Intergenic
1040107287 8:43548079-43548101 TCCACCCCAGGGTGCCTGGGGGG - Intergenic
1040988958 8:53328375-53328397 TCCTCCCCAGGCCCACTGTGGGG - Intergenic
1042895749 8:73665721-73665743 TCATCCCTAGGTTATCTGTGGGG + Intronic
1043390883 8:79790570-79790592 TCCTGCTCAGGCTACCAATGAGG + Intergenic
1044698056 8:94942713-94942735 TGTTCTCCAGGCTACCTGGGTGG + Intronic
1047210273 8:122834963-122834985 TCCTGCCCAGCCTACTGGTGCGG - Intronic
1047316584 8:123740441-123740463 TCCACACCAGGCACCCTGTGTGG - Intergenic
1048858207 8:138701784-138701806 GGCTCCCCAGGCCACCTATGTGG - Intronic
1049556094 8:143282980-143283002 CCCTCCCCGGGCCTCCTGTGGGG - Intergenic
1049664067 8:143835361-143835383 TCCTACCCAGGCTGCCTGGCCGG - Exonic
1050163203 9:2739144-2739166 TCTTCCCCAGGATACCTGTGGGG - Intronic
1052357256 9:27517908-27517930 TTCTTCTCAGGCTACCTGCGGGG + Intronic
1054461248 9:65466043-65466065 GCTTCCCCAGGCCATCTGTGGGG - Intergenic
1055785059 9:79863169-79863191 TCCTCTCCAGGCAGCTTGTGTGG + Intergenic
1056751470 9:89354705-89354727 TCCTCTCGAGGCTGCCTGTCAGG - Intronic
1060518979 9:124283175-124283197 TCATCCCCAGCCTTCCTGAGAGG - Intronic
1061675192 9:132211616-132211638 CCCTCCCCAGCCTTCCTGTCTGG + Intronic
1062042242 9:134409457-134409479 TCCTCCCGAGGCCAACTCTGTGG + Intronic
1062271714 9:135712909-135712931 CCCTCCCCAGGCCACATCTGGGG + Intronic
1187539258 X:20175414-20175436 TGCTTTCCAGGATACCTGTGAGG + Intronic
1188542523 X:31266455-31266477 TCCTTTCCAGGCTGCCAGTGTGG - Intronic
1190234230 X:48603720-48603742 ACCCCCCCAGGTTACCTGTGGGG + Intronic
1190257540 X:48774814-48774836 TCCTCCACTGGCCATCTGTGTGG - Intergenic
1199123208 X:144082446-144082468 TCCTGCCCATGCTTCCTGGGAGG + Intergenic
1199881470 X:151976773-151976795 TCATCCACAGGATAGCTGTGAGG + Intergenic
1199971774 X:152866874-152866896 ACCTTCCCAGCCTACCTGAGAGG - Intronic
1202119597 Y:21509468-21509490 TCCACCCCAGGCAACCGCTGTGG + Intergenic
1202122050 Y:21533009-21533031 TCCACCCCAGGCAACCGCTGTGG + Intronic
1202156957 Y:21896374-21896396 TCCACCCCAGGCAACCGCTGTGG - Intronic
1202159403 Y:21919915-21919937 TCCACCCCAGGCAACCGCTGTGG - Intergenic
1202185851 Y:22184830-22184852 TCCACCCCAGGCAACCGCTGTGG - Intergenic
1202205509 Y:22401566-22401588 TCCACCCCAGGCAACCGCTGTGG + Intronic