ID: 901304069

View in Genome Browser
Species Human (GRCh38)
Location 1:8219715-8219737
Sequence CTTAAACACTTCCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901304069_901304075 10 Left 901304069 1:8219715-8219737 CCTTGGCCTGGGAAGTGTTTAAG No data
Right 901304075 1:8219748-8219770 GGGGTTCTCCACAACGCTGAAGG No data
901304069_901304073 -10 Left 901304069 1:8219715-8219737 CCTTGGCCTGGGAAGTGTTTAAG No data
Right 901304073 1:8219728-8219750 AGTGTTTAAGGAGAATCTTTGGG No data
901304069_901304077 23 Left 901304069 1:8219715-8219737 CCTTGGCCTGGGAAGTGTTTAAG No data
Right 901304077 1:8219761-8219783 ACGCTGAAGGAAGCCCAATCTGG No data
901304069_901304074 -9 Left 901304069 1:8219715-8219737 CCTTGGCCTGGGAAGTGTTTAAG No data
Right 901304074 1:8219729-8219751 GTGTTTAAGGAGAATCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901304069 Original CRISPR CTTAAACACTTCCCAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr