ID: 901304074

View in Genome Browser
Species Human (GRCh38)
Location 1:8219729-8219751
Sequence GTGTTTAAGGAGAATCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901304069_901304074 -9 Left 901304069 1:8219715-8219737 CCTTGGCCTGGGAAGTGTTTAAG No data
Right 901304074 1:8219729-8219751 GTGTTTAAGGAGAATCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901304074 Original CRISPR GTGTTTAAGGAGAATCTTTG GGG Intergenic
No off target data available for this crispr