ID: 901305163

View in Genome Browser
Species Human (GRCh38)
Location 1:8227477-8227499
Sequence ATGAAGTAGGTGGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901305158_901305163 16 Left 901305158 1:8227438-8227460 CCGGTCAGAGGTTTCAGAGGTTG No data
Right 901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901305163 Original CRISPR ATGAAGTAGGTGGAGGAAGA TGG Intergenic
No off target data available for this crispr