ID: 901311655

View in Genome Browser
Species Human (GRCh38)
Location 1:8274026-8274048
Sequence CCCTGAATTTGGGTTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901311651_901311655 4 Left 901311651 1:8273999-8274021 CCAGGCAATGACAGCTGAGGACA No data
Right 901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG No data
901311649_901311655 6 Left 901311649 1:8273997-8274019 CCCCAGGCAATGACAGCTGAGGA No data
Right 901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG No data
901311646_901311655 29 Left 901311646 1:8273974-8273996 CCAAAGGTGACAGTTGTCACTTG No data
Right 901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG No data
901311650_901311655 5 Left 901311650 1:8273998-8274020 CCCAGGCAATGACAGCTGAGGAC No data
Right 901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901311655 Original CRISPR CCCTGAATTTGGGTTTCTCT TGG Intergenic