ID: 901313017

View in Genome Browser
Species Human (GRCh38)
Location 1:8284180-8284202
Sequence ACAAATATCCTACACTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901313017_901313022 15 Left 901313017 1:8284180-8284202 CCACAGCAGTGTAGGATATTTGT No data
Right 901313022 1:8284218-8284240 TGACATTCACCATTTTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901313017 Original CRISPR ACAAATATCCTACACTGCTG TGG (reversed) Intergenic
No off target data available for this crispr