ID: 901314382

View in Genome Browser
Species Human (GRCh38)
Location 1:8296036-8296058
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901314382_901314392 10 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314392 1:8296069-8296091 TTTTGGGAGGGGCCTCATGGTGG No data
901314382_901314388 -3 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314388 1:8296056-8296078 ACAGCGATGGGTATTTTGGGAGG No data
901314382_901314386 -7 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314386 1:8296052-8296074 GAGAACAGCGATGGGTATTTTGG No data
901314382_901314395 25 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG No data
901314382_901314389 -2 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314389 1:8296057-8296079 CAGCGATGGGTATTTTGGGAGGG No data
901314382_901314391 7 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314391 1:8296066-8296088 GTATTTTGGGAGGGGCCTCATGG No data
901314382_901314390 -1 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314390 1:8296058-8296080 AGCGATGGGTATTTTGGGAGGGG No data
901314382_901314393 19 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314393 1:8296078-8296100 GGGCCTCATGGTGGCCCCACAGG No data
901314382_901314387 -6 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314387 1:8296053-8296075 AGAACAGCGATGGGTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901314382 Original CRISPR TGTTCTCCCTGAGGAGCCCC AGG (reversed) Intergenic