ID: 901314385

View in Genome Browser
Species Human (GRCh38)
Location 1:8296045-8296067
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901314385_901314395 16 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG No data
901314385_901314392 1 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314392 1:8296069-8296091 TTTTGGGAGGGGCCTCATGGTGG No data
901314385_901314393 10 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314393 1:8296078-8296100 GGGCCTCATGGTGGCCCCACAGG No data
901314385_901314391 -2 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314391 1:8296066-8296088 GTATTTTGGGAGGGGCCTCATGG No data
901314385_901314390 -10 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314390 1:8296058-8296080 AGCGATGGGTATTTTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901314385 Original CRISPR ACCCATCGCTGTTCTCCCTG AGG (reversed) Intergenic