ID: 901314386

View in Genome Browser
Species Human (GRCh38)
Location 1:8296052-8296074
Sequence GAGAACAGCGATGGGTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901314382_901314386 -7 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314386 1:8296052-8296074 GAGAACAGCGATGGGTATTTTGG No data
901314381_901314386 -6 Left 901314381 1:8296035-8296057 CCCTGGGGCTCCTCAGGGAGAAC No data
Right 901314386 1:8296052-8296074 GAGAACAGCGATGGGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901314386 Original CRISPR GAGAACAGCGATGGGTATTT TGG Intergenic