ID: 901314389

View in Genome Browser
Species Human (GRCh38)
Location 1:8296057-8296079
Sequence CAGCGATGGGTATTTTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901314381_901314389 -1 Left 901314381 1:8296035-8296057 CCCTGGGGCTCCTCAGGGAGAAC No data
Right 901314389 1:8296057-8296079 CAGCGATGGGTATTTTGGGAGGG No data
901314382_901314389 -2 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314389 1:8296057-8296079 CAGCGATGGGTATTTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901314389 Original CRISPR CAGCGATGGGTATTTTGGGA GGG Intergenic
No off target data available for this crispr