ID: 901314393

View in Genome Browser
Species Human (GRCh38)
Location 1:8296078-8296100
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901314385_901314393 10 Left 901314385 1:8296045-8296067 CCTCAGGGAGAACAGCGATGGGT No data
Right 901314393 1:8296078-8296100 GGGCCTCATGGTGGCCCCACAGG No data
901314382_901314393 19 Left 901314382 1:8296036-8296058 CCTGGGGCTCCTCAGGGAGAACA No data
Right 901314393 1:8296078-8296100 GGGCCTCATGGTGGCCCCACAGG No data
901314381_901314393 20 Left 901314381 1:8296035-8296057 CCCTGGGGCTCCTCAGGGAGAAC No data
Right 901314393 1:8296078-8296100 GGGCCTCATGGTGGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type