ID: 901315029

View in Genome Browser
Species Human (GRCh38)
Location 1:8301260-8301282
Sequence ATCAATAACCTATAGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901315028_901315029 -3 Left 901315028 1:8301240-8301262 CCTGTAGCTGGAAGGGATTCATC No data
Right 901315029 1:8301260-8301282 ATCAATAACCTATAGCTGAGTGG No data
901315024_901315029 25 Left 901315024 1:8301212-8301234 CCTGTAGCTGGGCGGGATTCATC No data
Right 901315029 1:8301260-8301282 ATCAATAACCTATAGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901315029 Original CRISPR ATCAATAACCTATAGCTGAG TGG Intergenic
No off target data available for this crispr