ID: 901315044

View in Genome Browser
Species Human (GRCh38)
Location 1:8301344-8301366
Sequence ATCAATAACCTATAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901315041_901315044 -3 Left 901315041 1:8301324-8301346 CCTGTAGCTGGGTGGGATTCATC No data
Right 901315044 1:8301344-8301366 ATCAATAACCTATAGCTGGGTGG No data
901315036_901315044 25 Left 901315036 1:8301296-8301318 CCTGTAGCTGGGCGGGATTCATC No data
Right 901315044 1:8301344-8301366 ATCAATAACCTATAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901315044 Original CRISPR ATCAATAACCTATAGCTGGG TGG Intergenic
No off target data available for this crispr