ID: 901315063

View in Genome Browser
Species Human (GRCh38)
Location 1:8301456-8301478
Sequence ATCAATAACCTATAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901315061_901315063 -3 Left 901315061 1:8301436-8301458 CCTGTAGCTGGTCGGGATTCATC No data
Right 901315063 1:8301456-8301478 ATCAATAACCTATAGCTGGCTGG No data
901315057_901315063 25 Left 901315057 1:8301408-8301430 CCTGTAGCTGGGTGGGATTCATC No data
Right 901315063 1:8301456-8301478 ATCAATAACCTATAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901315063 Original CRISPR ATCAATAACCTATAGCTGGC TGG Intergenic
No off target data available for this crispr