ID: 901315223

View in Genome Browser
Species Human (GRCh38)
Location 1:8302579-8302601
Sequence ACTCCCGGCGTTACTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901315223_901315227 29 Left 901315223 1:8302579-8302601 CCACAGTGAGTAACGCCGGGAGT No data
Right 901315227 1:8302631-8302653 AGAACCTAAATGACGTTGTTGGG No data
901315223_901315226 28 Left 901315223 1:8302579-8302601 CCACAGTGAGTAACGCCGGGAGT No data
Right 901315226 1:8302630-8302652 AAGAACCTAAATGACGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901315223 Original CRISPR ACTCCCGGCGTTACTCACTG TGG (reversed) Intergenic
No off target data available for this crispr