ID: 901317311

View in Genome Browser
Species Human (GRCh38)
Location 1:8317959-8317981
Sequence CACCGGGACGGGCCTCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901317307_901317311 -8 Left 901317307 1:8317944-8317966 CCGTCGTGCGCGAAGCACCGGGA 0: 1
1: 0
2: 0
3: 2
4: 11
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92
901317302_901317311 15 Left 901317302 1:8317921-8317943 CCTGGCAGATCCTGCAGACCGCG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92
901317301_901317311 22 Left 901317301 1:8317914-8317936 CCGGGATCCTGGCAGATCCTGCA 0: 1
1: 0
2: 1
3: 11
4: 215
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92
901317303_901317311 5 Left 901317303 1:8317931-8317953 CCTGCAGACCGCGCCGTCGTGCG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92
901317300_901317311 25 Left 901317300 1:8317911-8317933 CCTCCGGGATCCTGGCAGATCCT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92
901317304_901317311 -3 Left 901317304 1:8317939-8317961 CCGCGCCGTCGTGCGCGAAGCAC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901317311 Original CRISPR CACCGGGACGGGCCTCCCGC GGG Intronic
900126904 1:1072776-1072798 CACCGGGGTGAGCCTCCCACAGG + Intronic
900206934 1:1435631-1435653 CTCGGGGAGGGGCCTCCCGGGGG + Intronic
901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG + Intronic
901702866 1:11054770-11054792 CCCCGGGCCGGACCTCCTGCTGG - Exonic
903275492 1:22218761-22218783 CACCAGGATGGGCCTCCTTCTGG - Intergenic
905505576 1:38476559-38476581 AACCGGGCCTGGCCTCCCCCCGG + Intergenic
912099931 1:106192273-106192295 CACTGGGAGGGGCCTCCCAACGG + Intergenic
916819824 1:168387295-168387317 CACGCGGCCGCGCCTCCCGCGGG - Intergenic
917415469 1:174804599-174804621 CACCGTGCCCGGCCTCCCTCGGG + Intronic
924743199 1:246809667-246809689 CACCAGGGGGAGCCTCCCGCAGG + Intergenic
1073578798 10:104645279-104645301 CACGGGGACTGGGCTCCCTCTGG - Intronic
1076834789 10:133015604-133015626 CATCGGGAGGGGCCTTTCGCAGG - Intergenic
1076994940 11:293275-293297 CACCGGGGCAGGTCTCCAGCTGG - Intronic
1077133416 11:986472-986494 CAGCTTGACCGGCCTCCCGCGGG + Intronic
1078003216 11:7513901-7513923 CTCCGGGAAGAGCCTTCCGCAGG + Exonic
1078338003 11:10478792-10478814 CACAGGGTCGTGCCTCCCTCTGG + Intronic
1090437455 11:126698532-126698554 CACCGGCCCGTGCATCCCGCAGG + Intronic
1106409792 13:29503258-29503280 CACCGGGTCGGTGCTCCCTCAGG - Exonic
1113767208 13:112888969-112888991 CACCGGGAAGGGGCTCCTGTGGG - Intergenic
1114324776 14:21577718-21577740 CACCGCGCCCGGCCTCCCTCGGG - Intergenic
1121279288 14:92687750-92687772 GAGGGGGACGGGCCCCCCGCAGG + Intronic
1121355017 14:93207065-93207087 CACCGGGAAGCGCCACCCGGAGG + Exonic
1122866195 14:104605037-104605059 CACCTGTACGGGCCTCACACAGG + Intronic
1123004849 14:105316199-105316221 CACCTGGCGGGGCCTCCCGAAGG + Intronic
1124640102 15:31391819-31391841 GCCCGGGAAGCGCCTCCCGCCGG - Intronic
1125527112 15:40383406-40383428 CACGGGGAAGGGCGTCCCGTCGG + Intronic
1130564568 15:84982246-84982268 CGGCGGGCCGCGCCTCCCGCAGG + Exonic
1132665221 16:1078420-1078442 TCCCGGGAGGGGCCGCCCGCTGG + Intergenic
1132676431 16:1123140-1123162 ACCAGGGACGGGGCTCCCGCAGG - Intergenic
1137578624 16:49620522-49620544 CACCGGGACAGGCCTGGCTCTGG + Intronic
1142856601 17:2734046-2734068 CACCGTGCCTGGCCTCCAGCTGG + Intergenic
1145246931 17:21275638-21275660 CCCAGGGCCGGGCCTCCCGAGGG - Intergenic
1146843031 17:36167940-36167962 CACCTGGCCGGACCTCCCTCTGG + Intronic
1146882550 17:36452020-36452042 CACCTGGCCGGACCTCCCTCTGG + Intergenic
1148215831 17:45833651-45833673 CCCCAGGACGGGCTGCCCGCTGG - Intronic
1150812610 17:68368550-68368572 GAGCAGGAAGGGCCTCCCGCTGG - Exonic
1152337884 17:79708271-79708293 CCCCATCACGGGCCTCCCGCAGG + Intergenic
1152644164 17:81461176-81461198 GACCGGGCCGGGCCTCCCCAGGG + Exonic
1152654880 17:81514822-81514844 CCCCGGGCCGGGCTTCCCGGCGG - Intronic
1153515391 18:5896136-5896158 CGCCGGGACGGGCGCACCGCGGG + Intergenic
1157251353 18:46098714-46098736 CCCCGGGACTGGCCACCAGCAGG + Intronic
1158676970 18:59529180-59529202 CACCGGGCAGGGCCTCCCTGTGG - Intronic
1160017408 18:75155200-75155222 CCCCGGGCTAGGCCTCCCGCAGG - Intergenic
1160453330 18:78979729-78979751 CTCCGGGAGGGGCCGCCCGGCGG + Intergenic
1160810394 19:1010665-1010687 CACAGGCCCGGGACTCCCGCTGG + Exonic
1160952925 19:1676089-1676111 CACCGGGACGCCCCCCCCACCGG - Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1164581312 19:29437094-29437116 CACTCAGAGGGGCCTCCCGCTGG + Intergenic
1167660179 19:50791753-50791775 CACCGGGATCGGCCTCCAGCGGG - Exonic
927652181 2:24919709-24919731 CTCCGGGACGGTCCCCGCGCGGG + Exonic
932556039 2:72825719-72825741 CTCTGGGTCGGGCCTCCGGCCGG - Intronic
934766437 2:96882678-96882700 GACCTGGAAGGGCCTCCCTCTGG - Intronic
935332507 2:101987465-101987487 CACCTGGCAGGGCCTCCAGCAGG - Intergenic
946966469 2:225042401-225042423 GCCCGGGGCGCGCCTCCCGCCGG + Exonic
948415363 2:237798951-237798973 CGCCGGGACCGGCCACACGCGGG - Intronic
948590734 2:239048000-239048022 GAGGGGGACGGGCCTGCCGCTGG + Intergenic
1168801393 20:645636-645658 CAGAGGGACGGCCCTGCCGCGGG + Intergenic
1170972122 20:21126000-21126022 CACCGCGCCGGGCCGCCTGCAGG - Intronic
1173509131 20:43612402-43612424 CACCGGGCCTGGCCTCCCTCTGG - Intronic
1174346878 20:49936649-49936671 CACCCAGAGGGGCCTCCCGGGGG + Intronic
1176943127 21:14947878-14947900 CACCTGGACGGGGCTCCCCATGG + Intergenic
1179628812 21:42664322-42664344 CACAGGGACGTGCCACCTGCAGG + Intronic
1180847488 22:18991894-18991916 CACCAGGACGGGCCTCTCCAGGG - Intergenic
1183956247 22:41382182-41382204 CACCGAGGCGCGCCTCGCGCGGG - Exonic
1184732931 22:46380856-46380878 CACCAGGACGGGCCTCTCCAGGG + Exonic
1185255186 22:49827727-49827749 CCCCGAGCCGGGCCTCCAGCTGG - Intergenic
954540867 3:51392218-51392240 GACGGGCACGGGGCTCCCGCAGG - Exonic
968134985 3:196214804-196214826 CTCCAGGCAGGGCCTCCCGCTGG + Intronic
968434007 4:575821-575843 CCCCGGGACGCGCCCCTCGCGGG - Intergenic
968522618 4:1040865-1040887 GCCCGGCACAGGCCTCCCGCTGG + Intergenic
968671857 4:1856255-1856277 CACCGGGACGGCCTGCACGCTGG + Intergenic
981782723 4:148445042-148445064 CACCGCGTCCGGCCACCCGCGGG + Intergenic
982257598 4:153466113-153466135 CGCCGGGGCGGGGCACCCGCGGG + Intergenic
985489948 5:173357-173379 CACAGGGACAGGCCTTCCCCTGG + Intronic
988110494 5:26813154-26813176 CACCAGGCAGGGCCTCCCACAGG + Intergenic
994816544 5:104593706-104593728 CACCTGGACTGTCCTCCCCCAGG + Intergenic
1002160559 5:177311944-177311966 CCCCGGGACGCCCCGCCCGCGGG + Exonic
1007902310 6:45423089-45423111 CCCCCGGCCGGGCCTCCCTCCGG + Intronic
1008545070 6:52576986-52577008 CACCGGCCCGGTCCGCCCGCCGG + Intergenic
1012399802 6:98834235-98834257 CACCGGGACCGCCCCCCTGCCGG + Intergenic
1014230202 6:118894581-118894603 TCCCGGGCCGGGCCTCGCGCTGG + Intronic
1019523821 7:1471959-1471981 CACCGGTACTGCCCACCCGCTGG + Intronic
1027051464 7:75023997-75024019 CACCGTGCCTGGCCTCCCACTGG - Intronic
1035435526 7:158856628-158856650 CGCTGGGACGCGCCTCCCGAAGG + Exonic
1038360132 8:26866906-26866928 CGCCGGGGCCGGCGTCCCGCAGG - Intronic
1042591585 8:70403002-70403024 CACGGGCCCGGGCCACCCGCCGG + Intronic
1043502801 8:80873828-80873850 CGCCGGGACCGGCCCCCCTCGGG - Intronic
1048856834 8:138693586-138693608 CACTGGGCGGGGCCTCCCTCCGG + Intronic
1049586945 8:143436664-143436686 CACCGGGAAGCGTCTGCCGCAGG - Intergenic
1049624409 8:143613615-143613637 CACCGGGTCAGGCCTCCCCTTGG + Intronic
1057075554 9:92136462-92136484 CTCTGTGACGGACCTCCCGCAGG + Intergenic
1058851123 9:109013132-109013154 CTCCGGGACGGGCCTCGGCCCGG - Intronic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1061400872 9:130367651-130367673 CACCGCGACCAGCCTCCCCCTGG - Intronic
1062186772 9:135222423-135222445 CACAGGGCCAGGCCTCCTGCAGG + Intergenic