ID: 901318856

View in Genome Browser
Species Human (GRCh38)
Location 1:8327053-8327075
Sequence GATCCAGCTGAGGCCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901318856_901318860 -2 Left 901318856 1:8327053-8327075 CCCTGCGGGGCCTCAGCTGGATC 0: 1
1: 0
2: 1
3: 17
4: 159
Right 901318860 1:8327074-8327096 TCACGCACCCTTGGAAGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901318856 Original CRISPR GATCCAGCTGAGGCCCCGCA GGG (reversed) Intronic
900287556 1:1908888-1908910 GCGCCGGCTGCGGCCCCGCAGGG - Intergenic
900852269 1:5153494-5153516 GAAGCAGCTGAGGCACCACAGGG - Intergenic
901318856 1:8327053-8327075 GATCCAGCTGAGGCCCCGCAGGG - Intronic
904210921 1:28886739-28886761 GATCCAGGTGAGTCTCCTCAGGG + Intergenic
904676326 1:32201229-32201251 GCTGCAGCTGAAGCCCAGCAGGG + Intronic
906499216 1:46328880-46328902 GATGCAACTGGAGCCCCGCAAGG - Intergenic
907309238 1:53529886-53529908 GATCCACCTGAGGAGCCACACGG - Exonic
911435088 1:97845889-97845911 GATCCAGCTGCAGCCTCACATGG + Intronic
912008757 1:104933891-104933913 GGTCCAGCTGCAGCCTCGCATGG + Intergenic
915950475 1:160186892-160186914 CATCTAGCTGGAGCCCCGCAGGG + Exonic
918493327 1:185106907-185106929 GACCCAGCTGAGGCTGGGCACGG + Intergenic
919264106 1:195238436-195238458 CATCCAGCTGCAGCCTCGCATGG + Intergenic
919300815 1:195763357-195763379 GGTCCAGCTGCAGCCTCGCAAGG + Intergenic
919666947 1:200301589-200301611 GCTCCATCTGAGGCCCTGTAGGG + Intergenic
920097783 1:203497816-203497838 GATTCAGCTGAGGCCCTTTATGG - Intronic
920342977 1:205287207-205287229 GATCCAGCTTAGGCACCGCCTGG + Intergenic
920679266 1:208060265-208060287 GCTCCAGCGGAGGCCCTGCTCGG + Intronic
920710645 1:208291399-208291421 GACCCAGCTGAGGCCCTGTTAGG - Intergenic
922680661 1:227592696-227592718 GATGCAACTGGAGCCCCGCAAGG - Intronic
922954897 1:229590927-229590949 TAACCAGCTGAGGCCACGCATGG - Intergenic
923077471 1:230623052-230623074 GAACCAGCACAGGCCGCGCAGGG - Intergenic
924924942 1:248671336-248671358 GGTCCACCTGAGGCTCTGCAGGG + Intergenic
924925026 1:248671642-248671664 CATCCACCTGAGGCTCTGCAGGG + Intergenic
924925057 1:248671744-248671766 CATCCACCTGAGGCTCTGCAGGG + Intergenic
1065802312 10:29363774-29363796 GATGCAATTGAAGCCCCGCAAGG - Intergenic
1071288317 10:84169339-84169361 GATGCAATTGAAGCCCCGCAAGG - Intergenic
1071305242 10:84293788-84293810 GAACCAGCTGGGGCTCTGCAGGG - Intergenic
1074238126 10:111606980-111607002 GAGCCAGCTGACGCCCAGCATGG - Intergenic
1074273243 10:111975832-111975854 GATCCAGCTTAGGCCACATAGGG + Intergenic
1076463131 10:130660053-130660075 GCTCCAGCTGTGGCCACTCAGGG + Intergenic
1078130802 11:8612677-8612699 ACTCCAGCTGAGCCCCAGCAAGG + Exonic
1078351932 11:10602006-10602028 GATCTAGCTCAGGCCCTGCCTGG + Intronic
1083297331 11:61722037-61722059 CATCCAGCTCAGGCCCCTCAGGG - Intronic
1083889828 11:65590182-65590204 GATGCAGCTGAGGAGCCTCATGG + Exonic
1084958475 11:72703748-72703770 ACTCAAGATGAGGCCCCGCATGG - Intronic
1084961353 11:72718370-72718392 GGTCCAGCTGAGGCCCGGCTTGG + Intronic
1087210951 11:95446214-95446236 GGTCCAGCTGCAGCCTCGCAGGG - Intergenic
1087684612 11:101248966-101248988 GATGCAACTGGAGCCCCGCAAGG + Intergenic
1090211966 11:124927269-124927291 GAGGAAGCTGAGGCCCAGCAAGG - Intronic
1092278488 12:7081159-7081181 GATCCAGCGGTCGCCCAGCAGGG + Exonic
1098802888 12:74984882-74984904 GGTCCAGCTGTAGCCTCGCAAGG - Intergenic
1101574386 12:105983965-105983987 GAGGCAGCTGAAGCCCAGCAAGG - Intergenic
1102074353 12:110048219-110048241 GGTGCAGGTGAGGCCCCTCAGGG - Intronic
1102462506 12:113108721-113108743 GAGGCAACTGAGGCCCAGCAAGG + Intronic
1103048719 12:117761030-117761052 GTTCCAGCTGGGGCACCGCGTGG - Exonic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1104255757 12:127136133-127136155 GAGCCAGCTGAGGGCTCCCAAGG - Intergenic
1104736304 12:131137756-131137778 GATCCACCTCAGGCCTTGCAAGG - Intronic
1106511776 13:30419338-30419360 GATCCAGCAGAGGCCAGGAAAGG + Intergenic
1108848221 13:54700103-54700125 GGTCCAGCTGTGGCCATGCATGG - Intergenic
1109687892 13:65844537-65844559 GGTCCAGCTGCAGCCTCGCATGG + Intergenic
1112041459 13:95552554-95552576 GAGCCCTCTGAGGCCCCTCAAGG + Intronic
1112130094 13:96514037-96514059 CATCGCACTGAGGCCCCGCAAGG - Intronic
1113806778 13:113114656-113114678 GACCCAGCTGACCACCCGCATGG + Intronic
1114587159 14:23825609-23825631 GAGCCAGCTGCTGCCCCACACGG - Intergenic
1116617361 14:47155538-47155560 GCTCCAGCTGCGGCCTAGCAGGG + Intronic
1122663800 14:103315410-103315432 GATCCTGCTCTGGCCCCGGATGG - Intergenic
1123038605 14:105481378-105481400 GAGCCAGCCCAGGCCCCGCCAGG - Intergenic
1124352085 15:28963316-28963338 CATGCAGCTCAGGCCCGGCAGGG + Intronic
1128724772 15:69980331-69980353 GATCCAGTTTAGGCCCCTCAAGG + Intergenic
1129410649 15:75348578-75348600 GCTGCAGCCGCGGCCCCGCAAGG + Intronic
1130246844 15:82259449-82259471 ATTCCAGCTGAGGCCATGCATGG - Intronic
1130453806 15:84083572-84083594 ATTCCAGCTGAGGCCATGCATGG + Intergenic
1131250318 15:90825884-90825906 GCTCCACCTGAGGCCCCGTGGGG + Intergenic
1131670923 15:94618833-94618855 GAGCCAGCTTCGGCCCAGCATGG - Intergenic
1132575113 16:660570-660592 GATGCTGCTGGGGCCCAGCATGG - Intronic
1132673502 16:1112262-1112284 GCACCAGCGGAGGCCCCGCCTGG + Intergenic
1137342690 16:47625415-47625437 GAGACAGCTAAGGCCCCACAGGG - Intronic
1137351066 16:47714360-47714382 GATCCTGGTGAGGACCCACATGG + Intergenic
1138310616 16:56020463-56020485 GATCCAGAGGAGGCCCAGCTTGG + Intergenic
1141993276 16:87622198-87622220 GGACCAGCTGAGGCCTCGGAAGG - Intronic
1143081952 17:4388398-4388420 GAAGCAGCTGCGGCCCGGCACGG - Intergenic
1143956174 17:10671181-10671203 GATACAGCAGAGGCCGGGCATGG - Intergenic
1145270741 17:21403638-21403660 GGTCCAGCTGAGGCCCTAAAGGG + Intronic
1146000313 17:29126719-29126741 GACCCTGCTGAGGCCTCCCAGGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151703914 17:75756994-75757016 GTTCTCGCTGAGGCCCGGCACGG - Exonic
1152401128 17:80066892-80066914 GAGCCAGCTGTGGCCGGGCAAGG + Intronic
1152864099 17:82711997-82712019 GGTCCAGCTGCAGCCTCGCAGGG - Intergenic
1153949364 18:10045318-10045340 GATGTAGCTGAGGGGCCGCAGGG + Intergenic
1160216116 18:76933176-76933198 GAGCCAGCCGAGGCCGGGCATGG + Intronic
1160317989 18:77866009-77866031 GAGGAAGCCGAGGCCCCGCAGGG + Intergenic
1160544180 18:79641920-79641942 GACCCAGCCGAGACCCTGCAGGG + Intergenic
1162593929 19:11612709-11612731 AATGCAGTTGAGGCCCGGCAAGG - Intronic
1167128920 19:47571933-47571955 GACCCAGTTTAGGCCCCACAGGG + Intergenic
926088743 2:10036505-10036527 ATTCCTGCTCAGGCCCCGCAGGG + Intergenic
929014675 2:37482344-37482366 GGTCCAGCTGCAGCCTCGCAGGG + Intergenic
934647330 2:96066572-96066594 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
934840702 2:97622392-97622414 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
937129303 2:119495458-119495480 GAACCAGGTGAGACCCCACAAGG - Intronic
937129383 2:119496072-119496094 GAACCAGGTGAGACCCCACAAGG - Intronic
943966298 2:194338171-194338193 AATCCAGCTGAGGCCGGGCGCGG + Intergenic
946399429 2:219460817-219460839 GACCCAGCTGAGGCCCTGCACGG - Intronic
948449700 2:238061315-238061337 GTGCGAGCTGTGGCCCCGCAAGG + Intronic
1168760137 20:344884-344906 GAACCAGATGAGGCCAGGCACGG - Intergenic
1171446489 20:25207847-25207869 TATCCAGCTGAGACCCCTCTCGG - Intronic
1171518834 20:25760326-25760348 GATCCAGGGGAGGACCCGGAGGG - Intergenic
1171558021 20:26095884-26095906 GATCCAGGGGAGGACCCGGAGGG + Intergenic
1172061310 20:32189250-32189272 GAGCCAGGGGAGGCCTCGCAAGG - Intergenic
1173404392 20:42752376-42752398 GAGCCAGCTGAGGCCCCAAGAGG + Intronic
1175138663 20:56843480-56843502 GGTCCAGCTGCAGCCTCGCAGGG + Intergenic
1177262704 21:18750702-18750724 GGTCCAGCTGAAGCCTCACAGGG + Intergenic
1178342068 21:31794158-31794180 GATCCATCTGAGGCCACGCTTGG + Intergenic
1179221078 21:39408123-39408145 GATCTGGCTGCAGCCCCGCAAGG - Intronic
1179243401 21:39610911-39610933 GTTCCAGCTGAGACCCCCCATGG - Intronic
1180975151 22:19844097-19844119 GAGCCAGGTGGGGCCCAGCACGG + Intronic
1181044922 22:20209947-20209969 GCACCAGCTGAGGCCCTGCCAGG + Intergenic
1182485362 22:30635753-30635775 GCTCCAGCTCAGGCCCGGCACGG - Exonic
1183206008 22:36419420-36419442 GCCCCAGCTGAGGCCCTGAAAGG - Intergenic
1183232204 22:36590078-36590100 GATGCAGCTGGGGCCCTGCTGGG - Intronic
1183743058 22:39678913-39678935 GCTTCAGCTAAGTCCCCGCATGG - Intronic
1184358359 22:43997504-43997526 GTTGCAGGTGATGCCCCGCAGGG + Intronic
949879217 3:8648707-8648729 GATGTAGCTGAGGCCCCTCTTGG + Intronic
950407332 3:12812982-12813004 GGTCCAGGTGAGCCCCTGCAGGG - Exonic
951520055 3:23603067-23603089 TATCCAGCTGCCGCACCGCAGGG + Intergenic
951612427 3:24505643-24505665 ATTCCAGCTGAGGGCCCCCAAGG - Intergenic
960973758 3:123156781-123156803 GGTCCAGCTGAGGCACCGAGGGG + Intronic
961389709 3:126545057-126545079 GATCCAGCTGGGATCCCACAGGG - Intronic
961882225 3:130070023-130070045 GATCCTGATGAGGACCAGCAAGG + Intergenic
963250308 3:143096453-143096475 GGTCCAGCTGTAGCCCTGCAGGG + Intergenic
965590436 3:170356989-170357011 GGCCCAGCTGCGGCCCCGCAGGG + Intergenic
968193495 3:196688371-196688393 CATCAAGCTGAAGCCCAGCAGGG + Intronic
968245573 3:197143544-197143566 GATCCAGCTGTTGCCAGGCACGG - Intronic
969491176 4:7500037-7500059 GACCCAGCTGCGGCCCCAGATGG + Intronic
972890487 4:43551424-43551446 GAGGCAGCTGAGGCCCAGCGTGG - Intergenic
973719657 4:53710550-53710572 TTTTCAGCTGAGGCCCAGCAAGG + Intronic
974761710 4:66285217-66285239 GGTCCAGCTGCAGCCTCGCATGG - Intergenic
975915956 4:79325669-79325691 GAACCAGATGATGTCCCGCATGG - Exonic
978149248 4:105414519-105414541 GGTCCAGCTGCAGCCTCGCAGGG - Intronic
978183891 4:105835451-105835473 GGTCCAGCTGCAGCCTCGCAGGG - Intronic
979292228 4:118990898-118990920 TATCCAGCTTAGGCCGGGCATGG - Intronic
983234872 4:165167833-165167855 TATCCAGCTGAGGTCACACAAGG + Intronic
984834033 4:184002525-184002547 GAGCCAGGTGGGGCCCAGCAGGG + Intronic
985725108 5:1512014-1512036 GGTCCTGCTGAGGCCAGGCAAGG + Intronic
993202143 5:84830265-84830287 GCTCCACCTGCGGCCCCCCACGG - Intergenic
994353433 5:98770630-98770652 GATCCCGCTGAGCCCCCTCCAGG + Exonic
996540375 5:124625376-124625398 GGGGCAGCTGAGGCCCTGCATGG - Intergenic
1001960761 5:175879150-175879172 GATCCAGGGGAGCCCCAGCAGGG - Intronic
1003022952 6:2527975-2527997 GATTAAGCAGAGGCCCTGCAAGG - Intergenic
1003507764 6:6753525-6753547 GATACAGCTGAGGAACCGCCAGG - Intergenic
1006160833 6:32039814-32039836 GATGCAGCTGAGGCAGCACAAGG + Exonic
1006380977 6:33697036-33697058 ACTGCAGCTGAGGCCCCGCTTGG + Exonic
1009241614 6:61192809-61192831 GGTCCAGCTGCAGCCTCGCAGGG - Intergenic
1016451400 6:144186851-144186873 GATGCTGCTGAGGCGCCGCATGG - Exonic
1016451420 6:144186961-144186983 GAGGCGGCTGAGGCCCAGCACGG + Exonic
1019180908 6:170186903-170186925 GATGCTGCTCAGCCCCCGCAGGG - Intergenic
1019709312 7:2511116-2511138 GACCCAGCTGGGGCTCAGCAGGG - Intergenic
1020383119 7:7567221-7567243 GCTCCCGCTGAGGCCCGGCCAGG - Intronic
1022455706 7:30556577-30556599 GAGGCAGCAGAGGCCCGGCATGG + Intergenic
1025954314 7:66170786-66170808 CTTCCAGCTAAGGCCCCACAAGG - Intergenic
1026401430 7:70017583-70017605 GCTCCAGCTGATCCCCTGCAGGG - Intronic
1026905304 7:74059737-74059759 GAGGAAGCTGAGGCCCAGCAAGG + Intronic
1029200584 7:98836650-98836672 AATCCAGTTGAGGCCGGGCACGG - Intergenic
1029459065 7:100685111-100685133 GATCCAGCTGAGTCCCGGGGTGG - Exonic
1029547290 7:101217139-101217161 GATCCCGGGGAGGCCCGGCACGG - Intronic
1032191773 7:129769872-129769894 GATCCTGCTGAGGCCATGGAGGG - Intergenic
1032782402 7:135174477-135174499 GATGCAATTGAAGCCCCGCAAGG + Intergenic
1034101695 7:148456615-148456637 GGTCCAACTGAGGCCTCGCAGGG - Intergenic
1046758165 8:117992629-117992651 GTGTCAGCTGAGGCCCTGCAGGG - Intronic
1048854297 8:138673497-138673519 GATCCGGCTGGGGCCGGGCATGG - Intronic
1049299691 8:141862975-141862997 GAGCCAGCTGAGGCCCAGTTGGG + Intergenic
1049596119 8:143484133-143484155 GGTCCAGCTGAGGCTGAGCACGG + Intronic
1049624657 8:143614590-143614612 CATCCTGCTGAGGCCCAGCCAGG - Intronic
1049633983 8:143676114-143676136 GATGCAGTTGGGGCCCCTCAAGG + Intergenic
1049658532 8:143809472-143809494 ATCCCAGCTGAGGCCCCGCAGGG + Intronic
1049799025 8:144509276-144509298 GTTCCAGGTGGGGTCCCGCAAGG - Exonic
1050182436 9:2935048-2935070 GGTCCAGCTGTGGCCTTGCAGGG + Intergenic
1052997582 9:34559453-34559475 GGTCCAGCTGAGACCCCACAGGG + Intronic
1053445153 9:38146959-38146981 GGTCCAGCTGTAGCCTCGCAGGG + Intergenic
1058487577 9:105457874-105457896 GGTCCAGCTGCAGCCTCGCATGG - Intronic
1059422144 9:114198867-114198889 GAGGCAGCTGAGGCCCAGCAAGG - Intronic
1061194518 9:129100495-129100517 GCTGCAGGTGAGGCCCGGCAGGG - Exonic
1061236209 9:129344085-129344107 GTTCCTGCTGAGGCCCAGCAGGG + Intergenic
1062496313 9:136833296-136833318 GATCCAGCTGGGGCAGCCCAGGG - Intronic
1185576813 X:1181028-1181050 TATCCAGGTGTGGCCCGGCAGGG + Intergenic
1189390848 X:40575359-40575381 GATGCAGCTGAGTCTCCCCACGG + Intergenic
1197342321 X:125288427-125288449 GATCCAGCTGTAGCCTTGCAGGG + Intergenic
1200155805 X:153974353-153974375 ACACCAGCTGAGGCCCCGCATGG - Intronic