ID: 901318886

View in Genome Browser
Species Human (GRCh38)
Location 1:8327363-8327385
Sequence CCCTAATGGCAGTGGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901318886_901318892 13 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318892 1:8327399-8327421 AGGTGTGAGGTCAGCCCCACTGG 0: 1
1: 0
2: 0
3: 19
4: 168
901318886_901318895 22 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318895 1:8327408-8327430 GTCAGCCCCACTGGTCTCTGGGG 0: 1
1: 1
2: 6
3: 23
4: 218
901318886_901318890 -7 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318890 1:8327379-8327401 ATTAGGGACACACAAACAAAAGG 0: 1
1: 0
2: 3
3: 27
4: 324
901318886_901318891 0 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318891 1:8327386-8327408 ACACACAAACAAAAGGTGTGAGG 0: 1
1: 1
2: 7
3: 62
4: 618
901318886_901318896 26 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318896 1:8327412-8327434 GCCCCACTGGTCTCTGGGGCTGG 0: 1
1: 0
2: 2
3: 37
4: 389
901318886_901318894 21 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318894 1:8327407-8327429 GGTCAGCCCCACTGGTCTCTGGG 0: 1
1: 1
2: 5
3: 12
4: 145
901318886_901318893 20 Left 901318886 1:8327363-8327385 CCACAGAGCCACTGCCATTAGGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 901318893 1:8327406-8327428 AGGTCAGCCCCACTGGTCTCTGG 0: 1
1: 1
2: 1
3: 21
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901318886 Original CRISPR CCCTAATGGCAGTGGCTCTG TGG (reversed) Intronic
900542396 1:3209721-3209743 CCCTCAGGGAAGGGGCTCTGTGG - Intronic
901318886 1:8327363-8327385 CCCTAATGGCAGTGGCTCTGTGG - Intronic
902801150 1:18831022-18831044 CACAGATGGCAGTGGGTCTGAGG + Intergenic
904334745 1:29789650-29789672 CCCCAAGGGAAGTGGCACTGGGG + Intergenic
904909414 1:33922684-33922706 TCCTCATGGCAGAGGCTCAGGGG + Intronic
906166455 1:43689984-43690006 CACAAATGGCATAGGCTCTGGGG + Intronic
907113657 1:51949847-51949869 CCCAAAAGGCTGTGGCACTGTGG - Intronic
907663779 1:56416674-56416696 CCCAAATCACAGTGGCTCTGAGG - Intergenic
908113648 1:60920809-60920831 CCTTAATGGAACAGGCTCTGGGG - Intronic
911255823 1:95632073-95632095 ACCTAATGGAAGTTGCTCTGGGG + Intergenic
913115686 1:115694551-115694573 ACCTAAGGGCTGTAGCTCTGTGG + Exonic
915268255 1:154733897-154733919 CCCTGAGGGCAGGGGCTGTGTGG - Intronic
915269628 1:154744512-154744534 ACCTACTGGCAGTGGCTGAGCGG - Intronic
915274966 1:154782212-154782234 CCCTGGTGGGAGTGGGTCTGTGG - Intronic
916398610 1:164420551-164420573 CTCTGATGGCAGAGGCTTTGTGG - Intergenic
919726369 1:200887494-200887516 CCCTAATGCCCGGGCCTCTGTGG - Intergenic
920614622 1:207478010-207478032 TCCGATTGGCACTGGCTCTGGGG - Exonic
922460928 1:225813822-225813844 GCCTAATGGGTGTGGCTGTGCGG - Intronic
922555616 1:226529986-226530008 CACTTATGGCAGTACCTCTGAGG - Intergenic
922884917 1:229012093-229012115 CCTTATGGGCAGCGGCTCTGTGG - Intergenic
922984536 1:229856108-229856130 CTCTCAAGGCAGTGGCTTTGGGG - Intergenic
924821627 1:247496746-247496768 CCCTAATGGAATGAGCTCTGAGG + Intergenic
1063062258 10:2568108-2568130 CTCCAGTGGCAGTGTCTCTGTGG + Intergenic
1063572992 10:7233798-7233820 CACTAAAGCCAGGGGCTCTGTGG + Intronic
1064118303 10:12597500-12597522 CCCTCATGGTAGGGGCTCTGGGG + Intronic
1070288090 10:75098245-75098267 CCCAGATGGCTGTGGCTCTCAGG + Intronic
1070784924 10:79157434-79157456 GCCTAATGACAGGAGCTCTGAGG + Intronic
1071201095 10:83221326-83221348 CCCTGGTGGAAGTGTCTCTGGGG + Intergenic
1072199887 10:93149068-93149090 CACCAAAGGCAGGGGCTCTGAGG - Intergenic
1072220093 10:93319435-93319457 CCCTCATGGCAGTGCCTCTGAGG + Intronic
1074638060 10:115344397-115344419 CTTTGATGGCAGTGGCTATGAGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075439652 10:122469575-122469597 ACCCAGTGGCAGTGGCTCTTTGG - Intronic
1077891262 11:6419410-6419432 CCCGAATGGCGGCGGCTGTGCGG + Intronic
1078868855 11:15325320-15325342 CCCTAAAAGCTGTGGCTCTTTGG + Intergenic
1079949553 11:26784505-26784527 CCCCACTGGCAGTGCCTCAGTGG - Intergenic
1080222110 11:29917860-29917882 GCCTATTTACAGTGGCTCTGGGG + Intergenic
1081599835 11:44485361-44485383 CCCTAATGGCTGAGCCTCTCTGG + Intergenic
1083915566 11:65741072-65741094 CACACAAGGCAGTGGCTCTGTGG + Intergenic
1084180851 11:67445110-67445132 CCCTTAGGCCAGCGGCTCTGGGG + Intergenic
1084762256 11:71281341-71281363 CCCAAATGCCAGTGGGGCTGAGG + Intergenic
1086516132 11:87615425-87615447 TCCTAATCTCAGTGGCTATGGGG - Intergenic
1090321194 11:125844986-125845008 CCCTAGTGGGAGGGGCACTGTGG + Intergenic
1091642212 12:2246083-2246105 CCCTAACGGCAGGTGCTTTGTGG - Intronic
1092118900 12:6029941-6029963 TCCTGATGACAGTGGCTCTGGGG - Intronic
1092513534 12:9184203-9184225 CTCTGATGTCAGTGGCTGTGTGG - Intronic
1095983097 12:47983782-47983804 CCCTACTAGCTGTGGCTCTCAGG - Intronic
1097695549 12:62771840-62771862 CCATAATGGCAGAGGCTCAGGGG + Intronic
1097950903 12:65427383-65427405 CCATAGTGGCAGTGGCAGTGAGG + Intronic
1098221814 12:68278066-68278088 CCCTGATGGAGTTGGCTCTGAGG - Intronic
1099279219 12:80622537-80622559 CCGTAATGTCAGTGGTCCTGAGG + Intronic
1102246925 12:111361962-111361984 TCCTGGTGGCAGTGGCTCTCTGG - Exonic
1102299046 12:111758038-111758060 CCCTCAAGGCAGAGGATCTGAGG - Intronic
1105426524 13:20299467-20299489 CCCTAGTGGTAGTGGCTTTGGGG - Intergenic
1105531440 13:21224291-21224313 CCCTAACGACTGTGGTTCTGAGG - Intergenic
1106168111 13:27266805-27266827 CCTCAAAGGCAGGGGCTCTGAGG + Intergenic
1106752680 13:32791210-32791232 CACTAACGTCAGTGTCTCTGTGG - Intergenic
1108595854 13:51948564-51948586 CCCAAATGTCAGTAGCACTGAGG - Intronic
1112569611 13:100581868-100581890 CCCCTGTGGCAGTGACTCTGTGG + Intronic
1113733148 13:112657085-112657107 CCCTGATGGCAGAGCCGCTGTGG + Intronic
1113941866 13:114022583-114022605 CCCAGATGCCAGTGCCTCTGTGG - Intronic
1121406700 14:93723348-93723370 CCCTTCTGACTGTGGCTCTGGGG - Intronic
1121435683 14:93917650-93917672 CCCTAGTGGCAGAGGAGCTGGGG - Intergenic
1122152410 14:99732106-99732128 CCCAAATGACAGTGGCTCCTTGG + Intergenic
1122692161 14:103536551-103536573 CCCTAATGCCAGGAGCTTTGGGG + Exonic
1124645858 15:31437151-31437173 CACTACTGGCAGTGACTATGTGG - Intergenic
1125816395 15:42588658-42588680 CCCTAATCACTATGGCTCTGAGG + Intronic
1128816453 15:70612953-70612975 CCCTAAGGGCAGAGGTTTTGAGG + Intergenic
1130060945 15:80569591-80569613 CCCTAACTGCTCTGGCTCTGTGG - Intronic
1130175886 15:81570379-81570401 GCCTAGTGGAAGAGGCTCTGAGG - Intergenic
1132002436 15:98193552-98193574 CCCAAATGGCTGTGGGGCTGGGG - Intergenic
1132127589 15:99241813-99241835 CCCTCAGGGCAGTGGCTTTTAGG + Intronic
1133861335 16:9598181-9598203 GCCTCCTGGCAGTGGCTATGAGG - Intergenic
1135761876 16:25144406-25144428 TCCTGATGGCAGTAGCTTTGTGG - Intronic
1136031659 16:27507546-27507568 TCCTCATGGCAGTGGCTAAGTGG - Intronic
1138411016 16:56840380-56840402 CCCAACAGACAGTGGCTCTGGGG - Intronic
1139311990 16:66035164-66035186 CCTTGATGGCAGTGACACTGTGG - Intergenic
1139483106 16:67241484-67241506 CCCTGACGGGGGTGGCTCTGGGG - Intronic
1140981776 16:80117114-80117136 CCCTAAAGTCAGTGGGGCTGTGG + Intergenic
1141484144 16:84327883-84327905 CCCTGAGGGCAGCGGCTCTGTGG - Intronic
1141789164 16:86221923-86221945 CCCTAGTACCTGTGGCTCTGGGG - Intergenic
1142395983 16:89831836-89831858 CCCTTAGAGCACTGGCTCTGGGG + Intronic
1146763149 17:35495824-35495846 CCCTCATCCCAGTGGGTCTGGGG - Intronic
1147934619 17:44004674-44004696 CGCTGATGGCTGTGGTTCTGCGG + Exonic
1151315421 17:73318950-73318972 CCCTTATGTCATTGTCTCTGGGG + Intergenic
1153551060 18:6262196-6262218 CCCAACCTGCAGTGGCTCTGTGG + Intronic
1153837878 18:8980632-8980654 CCATTATGGCTGTGGCCCTGAGG - Intergenic
1156248708 18:35329985-35330007 CCCAAATGGCAGTAGTGCTGAGG - Intergenic
1157122728 18:44926619-44926641 CCCTATTGGCAGTTGCTCTGAGG - Intronic
1157331077 18:46704411-46704433 TCCGAATGCCAGTGGCTCTGGGG + Intronic
1157813138 18:50711924-50711946 TCCGAATGGGAGAGGCTCTGGGG - Intronic
1158103228 18:53854675-53854697 CTCTAGTGGGAGTGACTCTGAGG - Intergenic
1160701548 19:509906-509928 CCCCACTGGCTGTGTCTCTGGGG - Intronic
1161526946 19:4762043-4762065 CACAAATGGCAGAGCCTCTGAGG + Intergenic
1161816378 19:6502206-6502228 CCCGCATGGCGGTGGCGCTGAGG + Exonic
1163275209 19:16279274-16279296 CCCGAATGTCAGTGGTGCTGAGG + Intergenic
1164210589 19:23094108-23094130 CCCAAGTGGCTGCGGCTCTGGGG + Intronic
1164708889 19:30340199-30340221 CCCCAATGGCCATGTCTCTGGGG + Intronic
1167771881 19:51525806-51525828 TCCCATTGGCAGTGGCTCTGTGG + Intronic
1168281955 19:55310701-55310723 CCCAAATGGCAGTCGTGCTGAGG + Intronic
926297504 2:11579252-11579274 CCATGATGGCAGAGGCACTGGGG - Intronic
931721812 2:65072296-65072318 CCCTACTGCCTGGGGCTCTGGGG - Exonic
932621146 2:73265531-73265553 CCCTGAGGACAGTGGCCCTGGGG - Exonic
939201372 2:139039681-139039703 CCATAATGGCAATGGGTCAGGGG - Intergenic
947851435 2:233291686-233291708 CCCTATTCACTGTGGCTCTGTGG - Intronic
947960194 2:234229917-234229939 CCCTGAGGGCAGTGGATCTGTGG + Intergenic
1170569191 20:17623321-17623343 CCCCAATGGCAGGAGCTTTGCGG - Intronic
1172442834 20:34977990-34978012 CCATCATGGCAGTGGCACTGGGG - Exonic
1174620980 20:51874427-51874449 CCCAAATGCCAATAGCTCTGAGG + Intergenic
1178408421 21:32345021-32345043 CCATAATGTCAGTAGCACTGAGG - Intronic
1180110512 21:45645981-45646003 CCCTGGTGGCAGTGACTCAGAGG + Intronic
1184042485 22:41952298-41952320 CGCAGATGGCAGTGTCTCTGGGG + Intergenic
1184961298 22:47930750-47930772 CCCTAATGACAGTGGCAATAAGG - Intergenic
1185323018 22:50210516-50210538 CCCAAGTGGCCGTGGCTCTCTGG - Intronic
950424620 3:12918363-12918385 CCTCAGTGGCAGTGGCTCTGTGG - Intronic
950533773 3:13568074-13568096 TCCTAATGTCAGTGGCTTTACGG + Intronic
951168237 3:19507511-19507533 CCCTAATCGCTGTGGGGCTGGGG - Intronic
953544693 3:43855843-43855865 CCCTAATGGCAGAGCCTGTCAGG - Intergenic
955983446 3:64549636-64549658 CCCAAATGTCAGTGGTGCTGAGG - Intronic
956778793 3:72588244-72588266 CCCTAATGCCAGTGGGTTTCTGG - Intergenic
961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG + Intergenic
967131715 3:186476785-186476807 CCCTCAGGGCAGCAGCTCTGGGG + Intergenic
968850161 4:3073573-3073595 CACTAATCACAGTGCCTCTGTGG + Intergenic
980443004 4:132871566-132871588 CTGGAATGGCAGTGGCTATGGGG + Intergenic
980798136 4:137711647-137711669 CCCTCATGGCAGCAGCTGTGAGG + Intergenic
984762722 4:183376729-183376751 CCCCCAGCGCAGTGGCTCTGTGG + Intergenic
985468377 5:20037-20059 AGCTAATGCCAGTGGCTCTAAGG + Intergenic
985619517 5:946801-946823 CCATGCTGGGAGTGGCTCTGGGG + Intergenic
986575886 5:9212807-9212829 CCTTAAGGGCAGGGGCTCTGTGG - Intronic
990474023 5:56144166-56144188 CCCTCATGGAAATTGCTCTGTGG + Intronic
992141273 5:73799470-73799492 CCATAATGCCAGTGTCTCAGGGG + Intronic
993424791 5:87749558-87749580 CCCTACTGGCAGAGGCTATAAGG + Intergenic
994634448 5:102326770-102326792 GCCAAATGGCAGTGGATCAGTGG - Intergenic
997353061 5:133244585-133244607 CCCTCCTGGCAGTGGGTCTCTGG - Intronic
999042316 5:148427793-148427815 GACTAATGGGAGTGGCTCTGGGG + Intronic
999264696 5:150258816-150258838 CCCTACTGGCATCAGCTCTGGGG - Intronic
999746798 5:154598521-154598543 CCCTAAAGACAATGGCCCTGAGG - Intergenic
1001234785 5:170020195-170020217 CCTGAATGGCATTGCCTCTGTGG + Intronic
1001757127 5:174179182-174179204 CACTGGTGGGAGTGGCTCTGCGG + Intronic
1001885354 5:175285329-175285351 TGCTAATGGCAGTGGCTCAGAGG - Intergenic
1003913810 6:10766761-10766783 GGCTAATGGGTGTGGCTCTGAGG + Intronic
1006642257 6:35495582-35495604 CCCTAAAGGATGTGGTTCTGTGG - Intronic
1016934777 6:149441462-149441484 CCCTGATGGCAGAGGCCATGCGG + Intergenic
1017658549 6:156652451-156652473 CCCTCATTGAAGGGGCTCTGAGG - Intergenic
1018906186 6:168077561-168077583 CCCGATAGGAAGTGGCTCTGTGG + Intronic
1019341950 7:512582-512604 CCCTAATGGCGGGAGCTGTGAGG - Intronic
1019350643 7:552450-552472 TGGTGATGGCAGTGGCTCTGCGG - Intronic
1019743530 7:2687649-2687671 CCCTACAGTCAGTGGCCCTGAGG - Intronic
1020101247 7:5395340-5395362 CCCTATTGGCAGTGACCCCGGGG - Intronic
1020109306 7:5439417-5439439 CACTAAGGGCTGGGGCTCTGGGG - Intronic
1026340765 7:69432079-69432101 CCCTATTTGCAGCGGCTCTTTGG - Intergenic
1028649903 7:93139810-93139832 CACTAAAGGCAGTGGGTCTGAGG - Intronic
1029597934 7:101547411-101547433 TCCTAGTGGCAGTGCCCCTGGGG + Intronic
1030495228 7:110290321-110290343 TCCTAATGGAAGTGGTCCTGTGG + Intergenic
1030642940 7:112026353-112026375 CCCTAATGGCTGATGATCTGAGG + Intronic
1030743890 7:113141483-113141505 CCCAAATGCCAATGGTTCTGAGG + Intergenic
1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG + Intronic
1032018918 7:128395914-128395936 CCTAAATAGCAGAGGCTCTGAGG + Intronic
1032671460 7:134086599-134086621 CTCTCAAGGCAGTGGTTCTGGGG + Intergenic
1033616285 7:143017570-143017592 CCTTTATAGCAGTGGCTTTGAGG - Intergenic
1034268431 7:149792088-149792110 CCCCAATGCCACTTGCTCTGGGG + Intergenic
1034881755 7:154768043-154768065 CTCTAAGGGCAGTGGGGCTGAGG - Intronic
1035596280 8:860554-860576 CACTCATGGCAGTGACTCAGTGG + Intergenic
1038537079 8:28361005-28361027 CCCTTCTAGCAGTGGCTCCGAGG + Exonic
1038718018 8:30009279-30009301 CCCCAGTGGCGGTGGCACTGGGG - Intergenic
1040981726 8:53251631-53251653 CACTACTGGCGGCGGCTCTGCGG + Exonic
1042325111 8:67520135-67520157 CCTTAATGCCAGTGGATATGAGG + Intronic
1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG + Intergenic
1045363047 8:101450510-101450532 CCCAAATGGTGGTGTCTCTGGGG - Intergenic
1049309996 8:141928741-141928763 CCCAAATGTCAGTGGTGCTGAGG - Intergenic
1051666925 9:19474425-19474447 CCCTAATGCCGATGGCTATGGGG + Intergenic
1061251667 9:129429987-129430009 CCCTAATGCCTCTGGCTCAGAGG + Intergenic
1061860458 9:133465239-133465261 TCCTTATGGCACTGGCACTGGGG + Intronic
1186313616 X:8345899-8345921 CCCAAATGGCAGAGGCTGTGTGG - Intergenic
1187466488 X:19532288-19532310 CCCAAATTGAAGTGGCTGTGGGG - Intergenic
1187927834 X:24266286-24266308 CAGTAATTTCAGTGGCTCTGAGG + Intergenic
1191105326 X:56768792-56768814 CCCTTAGGGCTGTGGCTCGGTGG + Intergenic
1191106319 X:56774194-56774216 CCCTTAGGGCTGTGGCTCGGTGG + Intergenic
1191107312 X:56779596-56779618 CCCTTAGGGCTGTGGCTCGGTGG + Intergenic
1192562332 X:72135331-72135353 CCCAGCTGGCTGTGGCTCTGGGG + Intronic
1193925189 X:87475967-87475989 CTCAGATGGCAGTGGCTATGTGG - Intergenic
1194065392 X:89254192-89254214 TCCTAATTGCAGTAACTCTGTGG - Intergenic
1195174879 X:102305796-102305818 TCCAAATAGCAGAGGCTCTGAGG + Intergenic
1195183986 X:102381297-102381319 TCCAAATAGCAGAGGCTCTGAGG - Intronic
1196861415 X:120032306-120032328 GCCCAAGGTCAGTGGCTCTGAGG - Intergenic
1197437429 X:126448849-126448871 TGCTAGTGTCAGTGGCTCTGAGG - Intergenic
1197673707 X:129307570-129307592 CTACAATGGAAGTGGCTCTGAGG + Intergenic
1200719561 Y:6588276-6588298 TCCTAATTGCAGTAACTCTGTGG - Intergenic