ID: 901319212

View in Genome Browser
Species Human (GRCh38)
Location 1:8329590-8329612
Sequence GGCACCGGCCAGCCCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 549}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901319212 Original CRISPR GGCACCGGCCAGCCCAGCCC TGG (reversed) Intronic
900144410 1:1151603-1151625 GGCACTGCCAAGCCCAGGCCAGG + Intergenic
900192653 1:1358066-1358088 GTCAGCAGCCAGCCCAGGCCTGG + Intronic
900210933 1:1455564-1455586 GCCACAGCCCAGCCCAGCTCCGG - Intronic
900216756 1:1485883-1485905 GCCACAGCCCAGCCCAGCTCCGG - Intronic
900343438 1:2199400-2199422 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
900344932 1:2205981-2206003 GGCACCTGCAGGCCGAGCCCTGG - Intronic
900397712 1:2460061-2460083 GGCGCTGTCCAGCCCTGCCCAGG + Intronic
900486234 1:2924111-2924133 GGCACGGCCAACCCCAGCCCTGG - Intergenic
900546654 1:3233197-3233219 GCCACCGGCCACCCCCACCCTGG - Intronic
900953916 1:5875255-5875277 GGAACTGGCCGGCCCCGCCCAGG + Intronic
900958557 1:5904670-5904692 GAGGCCGGCCAGCCCAGCTCTGG - Exonic
901028770 1:6293925-6293947 GGCCCCGGGTAGCCCAGCCTTGG - Intronic
901319212 1:8329590-8329612 GGCACCGGCCAGCCCAGCCCTGG - Intronic
901667590 1:10835414-10835436 GCCCCCGGCAGGCCCAGCCCAGG - Intergenic
901934031 1:12615950-12615972 GGCTCCGGCCAGCCCGGCTAGGG + Intronic
902395860 1:16132310-16132332 TGAACCCGCCAGGCCAGCCCCGG + Intronic
902552691 1:17228861-17228883 GCCCCCAGCCTGCCCAGCCCTGG - Intronic
902759253 1:18570297-18570319 GGCACCGACCAGGCCTGGCCTGG + Intergenic
902839203 1:19064817-19064839 AGCACCTGGCGGCCCAGCCCTGG + Intergenic
903186806 1:21633741-21633763 GGTTCCGGCCAGTCCAGCACTGG + Intronic
903641097 1:24861000-24861022 GGCTGGGGCAAGCCCAGCCCGGG + Intergenic
903968770 1:27105854-27105876 GGCAAGGGCCTGCCCTGCCCTGG + Intronic
904410522 1:30322209-30322231 GGCCCAGGCCAGGCCAGCTCGGG - Intergenic
904419856 1:30384662-30384684 GGCTCCTGCCAGTCCACCCCAGG - Intergenic
905344972 1:37305286-37305308 GTCACTGGACTGCCCAGCCCTGG + Intergenic
905874623 1:41423993-41424015 GGCCCCTGCCTGGCCAGCCCCGG + Intergenic
905890543 1:41516112-41516134 GGCCCCGGCCAGCCCCGAGCTGG - Intronic
905912211 1:41662575-41662597 GGCAGCCGCCAGCCGCGCCCGGG - Intronic
906102667 1:43273111-43273133 GGCGGCGGCCAGCCCGGCCAGGG - Exonic
906345510 1:45012100-45012122 GGCAGCAGCCAGGGCAGCCCTGG + Intergenic
906788487 1:48637561-48637583 GGCACCAGCCACTCCTGCCCAGG + Intronic
907272365 1:53298502-53298524 GGCTCCAGCCAGCCCCACCCTGG + Intronic
907277671 1:53326286-53326308 GGCACCGCCCTGCCCTGCCCCGG - Intronic
911203756 1:95072604-95072626 GGAACCGGGCAGTCCAGCCAGGG - Intronic
911950821 1:104172266-104172288 GGCCTCGGCCAGCCCAGACAGGG - Intergenic
912301861 1:108526094-108526116 GGCACCTGCCAGCTCAGCCCTGG - Intergenic
912682963 1:111740391-111740413 TGCTCCTCCCAGCCCAGCCCTGG + Intronic
912844652 1:113068743-113068765 GGCGCCGGCGAGCGCCGCCCGGG + Intergenic
914674561 1:149898857-149898879 GGAACGGGCCAGACCACCCCAGG - Intronic
915079493 1:153342052-153342074 AGCACCCGCCAGGCCAGGCCAGG + Intronic
915238299 1:154501924-154501946 GGCCCCGGCCGGCTCGGCCCAGG + Exonic
915448722 1:155989943-155989965 GAAACCAGCCAGCCCTGCCCGGG + Intronic
915981061 1:160420214-160420236 GGGACTGGCAGGCCCAGCCCTGG + Intronic
917396996 1:174604037-174604059 GACACCAGCTAGGCCAGCCCAGG - Intronic
917477780 1:175383778-175383800 GGCACCTGCCAACCCAGGCCTGG + Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
919926416 1:202194059-202194081 GGCGCCCCCCAGCCCGGCCCGGG + Exonic
920180695 1:204130221-204130243 GGCCCCTACCTGCCCAGCCCTGG + Intergenic
920498778 1:206473335-206473357 GGCCCTGTCCAGCCCAGCCTTGG + Intronic
920515163 1:206579926-206579948 GGCAGCAGCCATCCCAGACCTGG + Intronic
921340473 1:214129269-214129291 GACACCTGCCAGCCCACCCAGGG + Intergenic
922335729 1:224616970-224616992 GGCTCCGGCGACCCCAGACCCGG - Exonic
922420848 1:225460393-225460415 GGTACCGCCCACCCCACCCCGGG + Intergenic
922729192 1:227941172-227941194 TTCACCTGGCAGCCCAGCCCCGG - Intronic
923200194 1:231703942-231703964 GGCAGCAGCCAGCCAAGCCCTGG + Intronic
923329155 1:232906637-232906659 GCCTCCGGCCAGGCCAGCGCGGG - Intergenic
923400715 1:233613836-233613858 GGGCCCCGGCAGCCCAGCCCAGG + Intergenic
924437044 1:244050290-244050312 GGTACCGGTCAGCCCAGCCCGGG + Intronic
924710222 1:246524992-246525014 GGCGCAGGCAAACCCAGCCCAGG - Intergenic
1062848398 10:725502-725524 GGCCGACGCCAGCCCAGCCCCGG - Intergenic
1062854593 10:773658-773680 GGCAGCGGCCAGCCTTGCCCTGG + Intergenic
1064119124 10:12604024-12604046 GGCACAGGCCAGCCCTGCCTAGG - Intronic
1065590261 10:27256406-27256428 GGCCTCGGCCAGCCCAGACAGGG - Intergenic
1068104095 10:52592060-52592082 GGCACTGGCCAGGCCAGCTAAGG - Intergenic
1068690030 10:59905816-59905838 GCCAGCCTCCAGCCCAGCCCCGG + Intronic
1068955359 10:62815617-62815639 CGCCCCGGCGCGCCCAGCCCCGG - Intronic
1069023991 10:63521208-63521230 GGATCCCGCCAGCCCAGCCCTGG + Intergenic
1070895611 10:79981536-79981558 TCCTCCCGCCAGCCCAGCCCAGG + Intronic
1071102962 10:82060841-82060863 CGCACCAACCAGCCCAGTCCAGG - Intronic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1071713410 10:88071936-88071958 GGGACCGGCCAGCCAATCCCTGG + Intergenic
1072617657 10:97060190-97060212 GGCCCAGGTCAGCCCAGCCCTGG + Intronic
1073071170 10:100794058-100794080 GTCACCATCCAGCCCAGCCAAGG - Intronic
1073434944 10:103510674-103510696 GGCAGGGGTCAGCCCAGCCAGGG - Intronic
1074901426 10:117819379-117819401 AGAACCGCCAAGCCCAGCCCTGG + Intergenic
1075092660 10:119452330-119452352 GGCACCTGGGTGCCCAGCCCAGG - Intronic
1075382790 10:122032529-122032551 GGGACAGGCCTGCCCAGTCCTGG + Intronic
1075724684 10:124605242-124605264 GGCACTGGCCTGCCCAGCTGGGG + Intronic
1076356475 10:129857368-129857390 GGCAGCCCCCAACCCAGCCCTGG + Intronic
1076409330 10:130234717-130234739 GGCACCACTCTGCCCAGCCCTGG + Intergenic
1076551108 10:131278706-131278728 GGCACCCCCCAGGCCAGCCTTGG - Intronic
1076673546 10:132136231-132136253 GCAACCGCCAAGCCCAGCCCTGG + Intronic
1076809140 10:132877748-132877770 GGCACAGGCCATCCCGGGCCCGG + Intronic
1076898521 10:133325759-133325781 GGCTCCGGCCGGCTCTGCCCAGG - Intronic
1076988585 11:257247-257269 GCCCCCAGCCAGCCCAGCCTTGG + Intergenic
1077030104 11:461672-461694 GGCACTGGCCAGGCCAGGCCTGG - Intronic
1077233988 11:1471089-1471111 GGCAGGGGTCAGCCCAGCCAGGG - Intronic
1077341323 11:2027654-2027676 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1077354699 11:2109725-2109747 GGGACTGCCCAGCCCAGCCGAGG - Intergenic
1077392827 11:2307928-2307950 GGCACCAGCTAGCCCAGTGCTGG - Intronic
1077419828 11:2444964-2444986 GGCCGCTGCCGGCCCAGCCCGGG - Intronic
1077507905 11:2940644-2940666 GGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1078402082 11:11037386-11037408 GCCTCAGCCCAGCCCAGCCCTGG - Intergenic
1078576859 11:12509883-12509905 GGCACAGGCAAGCCCAGCATAGG - Intronic
1079122429 11:17695631-17695653 TGCAGCGCCCAGCCCTGCCCTGG - Intergenic
1079284572 11:19117259-19117281 CTCACCTGCGAGCCCAGCCCCGG - Exonic
1081571432 11:44293855-44293877 GAACCAGGCCAGCCCAGCCCAGG - Intronic
1081755043 11:45538430-45538452 AGCACCGGCCACCCCAGCAGAGG + Intergenic
1082076760 11:47980955-47980977 GGCAGCGCCCAGCGCAGCCCGGG - Exonic
1083267276 11:61552427-61552449 GGCACTGGCCTGCCCCTCCCCGG + Intronic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1083602526 11:63957883-63957905 GGCTCCTGCCAGCCCTGGCCCGG + Intergenic
1083811371 11:65108616-65108638 GGCAGCGGCCAGCAGGGCCCCGG - Exonic
1083827496 11:65211736-65211758 GGCACAGGCGTTCCCAGCCCCGG - Exonic
1084000252 11:66292092-66292114 GGCTCCGGCCCCCCCAGCGCCGG - Intronic
1084267179 11:68010993-68011015 GGCTCGGGCCAACCCAGCCCCGG - Intronic
1084315443 11:68342921-68342943 GGCCCTGGCCAGCCCAGCCGAGG - Intronic
1084317859 11:68355634-68355656 GGGACCTGCCATCCCAGACCTGG + Intronic
1084698366 11:70769897-70769919 GGCACCAGCCAGCACACCCTGGG + Intronic
1085253537 11:75159401-75159423 GGCAACCGCCTGCCCAGCCCAGG + Intronic
1085259827 11:75198087-75198109 TGCACCAGCCAGTGCAGCCCAGG - Intronic
1085514103 11:77102506-77102528 GCCAGCACCCAGCCCAGCCCTGG + Intronic
1085524752 11:77157657-77157679 GGCCCACCCCAGCCCAGCCCAGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089617281 11:119702004-119702026 GTCACCGGCCTGCCCTGCTCTGG + Intronic
1089682806 11:120128882-120128904 AGCTCAGCCCAGCCCAGCCCAGG + Intronic
1089800616 11:121024166-121024188 GGTCCCGGCCAGCCCCGGCCCGG - Exonic
1090773935 11:129946862-129946884 GGCATCAGGCAGCCAAGCCCAGG - Intronic
1202824308 11_KI270721v1_random:82843-82865 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1091498347 12:991435-991457 TGCCCTGCCCAGCCCAGCCCGGG - Intronic
1091584050 12:1805879-1805901 GCCTGCGGCCCGCCCAGCCCAGG - Intronic
1091657097 12:2353764-2353786 GGCTCTGGCCATCTCAGCCCTGG - Intronic
1091928004 12:4371027-4371049 ACCACAGGCCAGGCCAGCCCGGG - Intronic
1094103744 12:26787143-26787165 GGCAGAGGCAAGCCCAGCTCAGG + Intronic
1094502065 12:31030654-31030676 TTTACAGGCCAGCCCAGCCCAGG + Intergenic
1095945529 12:47751350-47751372 CTCACTGCCCAGCCCAGCCCGGG + Intronic
1096159827 12:49367309-49367331 GGCAGCGGCTCGCCCCGCCCCGG - Intronic
1096526486 12:52213099-52213121 GGCACAGGGCAGCAGAGCCCTGG + Intergenic
1096648849 12:53052317-53052339 TGCCCCAGCCAGCCCAGTCCAGG + Intronic
1096789097 12:54034114-54034136 GGGCCAGCCCAGCCCAGCCCCGG - Intronic
1097041799 12:56160442-56160464 GGCCCTGCCCAGCCCAGCCCAGG + Intronic
1097263314 12:57731824-57731846 TGCACCGGGCAGCCAAGCGCAGG - Exonic
1097896021 12:64825229-64825251 GGCAGCGGCCACCCCAGGCGCGG + Intronic
1098105873 12:67068988-67069010 GGCACCGGGCGGCCCCGGCCCGG + Intergenic
1101107173 12:101452304-101452326 GGCACTGGTAATCCCAGCCCAGG - Intergenic
1101940721 12:109097621-109097643 GGAACCGGCGAGGCTAGCCCTGG - Exonic
1102028250 12:109725632-109725654 GGCACCAGGCAGCCCATTCCCGG + Intronic
1102166563 12:110811503-110811525 AGCACAGCCCAGCCCAGCCAGGG - Intergenic
1102197273 12:111034367-111034389 GGCAGCGGGCGGCCGAGCCCCGG - Intronic
1103726578 12:123000187-123000209 GGGACAGCCCAGCTCAGCCCTGG + Intronic
1103912527 12:124360255-124360277 GGCCCCAGGTAGCCCAGCCCTGG + Intronic
1104623756 12:130337443-130337465 GGCCCCGGCCAGCCCCACCCAGG - Intergenic
1104775734 12:131389215-131389237 GGCCACCTCCAGCCCAGCCCGGG - Intergenic
1104954833 12:132459268-132459290 GGCAGCAGCCAGCCCATCTCAGG + Intergenic
1104964951 12:132504695-132504717 CCCACCACCCAGCCCAGCCCTGG - Intronic
1105503454 13:20991170-20991192 GGCTCTGGCCAGGCCAGGCCAGG + Intronic
1106483976 13:30156757-30156779 GGCTCGGCCCTGCCCAGCCCCGG - Intergenic
1107748763 13:43542282-43542304 GGCACGTGCCACCACAGCCCCGG + Intronic
1108473263 13:50788338-50788360 GTCACAGGCCAGCCCAGAACTGG - Intronic
1108644031 13:52408495-52408517 AGCCTCAGCCAGCCCAGCCCAGG + Intergenic
1111271460 13:85892534-85892556 GGCACCCTGCATCCCAGCCCTGG + Intergenic
1113655700 13:112066969-112066991 GGCAGCGGGCAGCCCATCCCGGG + Intergenic
1113893681 13:113749601-113749623 GGCACCGACCTGCACAGACCTGG - Intergenic
1114155485 14:20099127-20099149 GGCATTGGCCAGCCCAGACAGGG - Intergenic
1121358185 14:93232277-93232299 GGCAGAGGCAGGCCCAGCCCTGG + Intergenic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1121569503 14:94936835-94936857 GGCACCGCCAAGGCCAGGCCGGG - Intergenic
1121611294 14:95282679-95282701 GGCACTTGCCACCTCAGCCCAGG + Intronic
1122178513 14:99938073-99938095 GGCCACGGCCAGGCAAGCCCAGG - Intronic
1122208614 14:100160612-100160634 GGCAACTGCCAGCCGAGGCCAGG - Intergenic
1122261843 14:100528062-100528084 GGGACAGCCCAGCCCAGCCCAGG - Intronic
1122514474 14:102297602-102297624 GGCCCCGGCCAGCCCAGGGAGGG - Intronic
1122543754 14:102511208-102511230 GGGTCAGGCCACCCCAGCCCAGG + Intergenic
1122594304 14:102878823-102878845 GGCACTGGGCAGCCCAGAACTGG + Intronic
1122602928 14:102930228-102930250 GCCGCCCGCCAGCCCAGCCGCGG - Exonic
1122904614 14:104795941-104795963 GCCACCAGCCAGCCCGTCCCGGG + Intergenic
1122939534 14:104975062-104975084 GGCAGCTCCTAGCCCAGCCCAGG + Intronic
1122971173 14:105152835-105152857 GGCCTGGGCCAGCCCTGCCCAGG + Intronic
1123042028 14:105494191-105494213 GCCAGCTGCCTGCCCAGCCCAGG - Intronic
1123051826 14:105547771-105547793 GGCCTCGGCCAGCCCAGACAAGG - Intergenic
1123059996 14:105590284-105590306 AGCCCAGGCCAGCCCAGCCCAGG + Intergenic
1123084315 14:105710582-105710604 AGCCCAGGTCAGCCCAGCCCAGG + Intergenic
1123084746 14:105712252-105712274 TGCTCAGCCCAGCCCAGCCCAGG + Intergenic
1123109374 14:105858538-105858560 AGCTCAGCCCAGCCCAGCCCAGG + Intergenic
1124696747 15:31870304-31870326 CGCGCCGGCGAGCCCAGCCGGGG + Intronic
1125903604 15:43370869-43370891 GGCGCCCTCCAGCCCACCCCTGG + Intronic
1127186847 15:56489198-56489220 GGCATTGGCCATCCAAGCCCCGG - Intergenic
1127681600 15:61303339-61303361 GGCACCTGCTCCCCCAGCCCTGG - Intergenic
1127867095 15:63042195-63042217 GGCACCCGCCAGCGCCTCCCCGG - Intergenic
1127964630 15:63914481-63914503 TGCACCTGCAAGCCCAGCCCTGG + Intronic
1128089788 15:64911773-64911795 TGCCCCGGCCACCCCAGTCCCGG - Intronic
1128999453 15:72320063-72320085 GGCCCGGGCCCGCCCCGCCCCGG - Exonic
1130770230 15:86916787-86916809 TTCACCGGCCTGGCCAGCCCCGG - Intronic
1132545653 16:531837-531859 GTCACCGGGCTGCCCAGACCAGG + Intronic
1132551794 16:556644-556666 GGCACTGGCCAGCAGCGCCCGGG - Intergenic
1132699050 16:1214521-1214543 AGTACCTCCCAGCCCAGCCCAGG + Intronic
1132789912 16:1679912-1679934 GGCACCCGCCACCCCACACCCGG - Intronic
1132934836 16:2475036-2475058 GGCTCCGGCCTGCCCGGCTCTGG - Intergenic
1132935008 16:2475604-2475626 GGCCCCGCCCCGCCCCGCCCAGG + Intronic
1133202470 16:4212641-4212663 GACTCCGGCCAGGCCAGGCCCGG + Intronic
1133233831 16:4378624-4378646 TGGCCCGGCCAGCCCACCCCAGG - Intronic
1134582447 16:15382093-15382115 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1135313767 16:21426144-21426166 GGCATGGGTCACCCCAGCCCTGG - Intronic
1135366691 16:21858424-21858446 GGCATGGGTCACCCCAGCCCTGG - Intronic
1135382905 16:22008655-22008677 GGGACTTGCCAGCCCAGCCCAGG - Intronic
1135445124 16:22512734-22512756 GGCATGGGTCACCCCAGCCCTGG + Intronic
1136193846 16:28637273-28637295 GGCATGGGTCACCCCAGCCCTGG + Intergenic
1136293598 16:29289920-29289942 GGCTCTGGTCAGCCCAGCCCGGG - Intergenic
1136310431 16:29404847-29404869 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1136323879 16:29506635-29506657 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1136438564 16:30246618-30246640 GGCATGGGTCACCCCAGCCCTGG - Intronic
1136514373 16:30759142-30759164 GGCCCAGCCCAGCCCTGCCCTGG + Exonic
1136711568 16:32241225-32241247 GGCAGCAGCCAGCCCTGCCTGGG + Intergenic
1136756347 16:32688180-32688202 GGCAGCAGCCAGCCCTGCCTGGG - Intergenic
1136811765 16:33182194-33182216 GGCAGCAGCCAGCCCTGCCTGGG + Intergenic
1136818241 16:33292274-33292296 GGCAGCAGCCAGCCCTGCCTGGG + Intronic
1136824805 16:33348807-33348829 GGCAGCAGCCAGCCCTGCCTGGG + Intergenic
1136829871 16:33447578-33447600 GGCAGCAGCCAGCCCTGCCTGGG + Intergenic
1137609476 16:49809300-49809322 GGCAGGGGCCGGCCCGGCCCTGG + Intronic
1138385342 16:56632530-56632552 GGCTCAGCCCAGCCCAGCCCAGG + Exonic
1138496392 16:57411778-57411800 GGCACAGGGCAGCCCTGACCTGG - Intronic
1139493917 16:67302288-67302310 GCCACCCGCCAGCCCAGGCTCGG - Intronic
1139505759 16:67397414-67397436 GGCCCAGGCCTGCCCAGTCCTGG + Intronic
1139858114 16:69997233-69997255 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1139949160 16:70660869-70660891 AGCCCAGCCCAGCCCAGCCCAGG + Intergenic
1140442557 16:74999045-74999067 AGCGCCGGCGAGCGCAGCCCGGG + Exonic
1141268892 16:82521339-82521361 GGCACCCACAGGCCCAGCCCAGG - Intergenic
1141641211 16:85342741-85342763 GCCACTGGCCTCCCCAGCCCGGG + Intergenic
1141670640 16:85489997-85490019 GGCACAGCCCTGCCCACCCCTGG + Intergenic
1141907814 16:87039156-87039178 AGCAAGGACCAGCCCAGCCCAGG - Intergenic
1142099480 16:88263926-88263948 GGCTCTGGTCAGCCCAGCCTGGG - Intergenic
1142116138 16:88357092-88357114 GCCAAGGGCCAGCCCGGCCCGGG - Intergenic
1142130240 16:88428860-88428882 TTTAACGGCCAGCCCAGCCCAGG + Exonic
1142211916 16:88812402-88812424 GCCCCCGGCCGGTCCAGCCCAGG - Intergenic
1142279112 16:89138443-89138465 GGCACCAGCCAGACGAGCCTTGG - Intronic
1202990343 16_KI270728v1_random:5162-5184 GGCAGCAGCCAGCCCTGCCTGGG + Intergenic
1203058486 16_KI270728v1_random:948534-948556 GGCAGCAGCCAGCCCTGCCTGGG - Intergenic
1142480104 17:213839-213861 GGCACCAGACACCTCAGCCCAGG + Exonic
1142733967 17:1882891-1882913 GGCAGTGGCCAGACCACCCCAGG - Intronic
1143482313 17:7234707-7234729 GGCACAGGCCAGCTTAGCCTGGG - Intergenic
1143503491 17:7351848-7351870 AGGCCCGGCCGGCCCAGCCCGGG - Intergenic
1144052836 17:11511864-11511886 GCTAACAGCCAGCCCAGCCCTGG + Intronic
1144185089 17:12789555-12789577 GGCACCGGCCCGCTCCGCCCGGG - Exonic
1144340256 17:14304078-14304100 TGCAGCGGACAGCGCAGCCCGGG + Intronic
1144851390 17:18245855-18245877 GGGAAAGGCCAGTCCAGCCCAGG + Intronic
1144854047 17:18258413-18258435 GTCCCCGGCCTGCCCAGCCTCGG + Intronic
1145778315 17:27544795-27544817 GGGGCCTGCTAGCCCAGCCCTGG - Intronic
1147185310 17:38710243-38710265 GGCAGAGGCAAGCCCAGCTCGGG - Intronic
1147315518 17:39618253-39618275 GGCACAGGGCGGCCCCGCCCGGG - Intergenic
1147813851 17:43193916-43193938 TCCACAGGCCAGCCCAGGCCAGG - Intronic
1147862754 17:43533211-43533233 GGCACCTCCCAGCCCCACCCTGG - Exonic
1147930486 17:43977506-43977528 GGCACCTGCCCGCCCAACACTGG + Intronic
1148957677 17:51366993-51367015 GGCACCGGCCAGCCACAACCTGG + Intergenic
1149516862 17:57287515-57287537 AGCAGCGGCCAACCAAGCCCAGG - Intronic
1149655952 17:58309700-58309722 GGCACCGGCCTCCCCTGGCCAGG + Intronic
1149693566 17:58598691-58598713 GGCAACGTCAAACCCAGCCCTGG + Intronic
1150649431 17:67000352-67000374 GGCACAGGACAGCCCAGGCGTGG - Intronic
1151660278 17:75515184-75515206 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
1151671674 17:75574500-75574522 GGCACCGCCCAGGCCAGCTGGGG + Intronic
1151715347 17:75828218-75828240 GACCCGCGCCAGCCCAGCCCAGG + Intronic
1151764013 17:76122770-76122792 GGCACAGGGAAGCCCTGCCCGGG + Intergenic
1151917533 17:77129476-77129498 GGCACCCTACAGCCCTGCCCGGG - Intronic
1152194448 17:78908909-78908931 AGGACCAGCCTGCCCAGCCCAGG - Intronic
1152226306 17:79094422-79094444 AGCCCAGGCCCGCCCAGCCCTGG - Intronic
1152241948 17:79165501-79165523 TGCACCTGCCAGCTCTGCCCAGG - Intronic
1152305535 17:79518412-79518434 GGCCCCGGCCAGGCCATCACAGG - Intergenic
1152466816 17:80471235-80471257 GGCACCGACCACCTCTGCCCTGG + Intronic
1152564251 17:81093078-81093100 AGCCCAGCCCAGCCCAGCCCAGG - Intronic
1152924467 17:83080811-83080833 GGCCCGGGCCAGCCCGGCCACGG - Intronic
1153631278 18:7072785-7072807 AGCACCTGCCAGCCCAGCTTTGG + Intronic
1153688246 18:7567381-7567403 GGCAGCCCCAAGCCCAGCCCCGG - Exonic
1154119560 18:11640505-11640527 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1154214874 18:12408319-12408341 GGCTCCGGCCGCCCCCGCCCCGG - Intronic
1155261731 18:24050050-24050072 GGCACCAGCCAGCCAGGCCTGGG - Intronic
1156231256 18:35155917-35155939 GCCACAGGCCACCCCACCCCTGG + Intergenic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1156467312 18:37356011-37356033 AGCCCAGCCCAGCCCAGCCCTGG + Intronic
1157384284 18:47248281-47248303 GGCACCAGCCAGCTCTGCCAAGG + Intronic
1157610006 18:48950241-48950263 GGCAGCATCCAGCCCTGCCCGGG + Exonic
1160156534 18:76438131-76438153 GGCACCAGGCATCCCAGTCCAGG + Intronic
1160722461 19:603478-603500 GGCACCTGCGGGACCAGCCCCGG - Intronic
1160742795 19:695163-695185 GTCTCTGCCCAGCCCAGCCCTGG - Intronic
1160806496 19:994417-994439 GGCCCCCACCAGCCCAGGCCTGG + Exonic
1160851607 19:1195486-1195508 GGCTTCTGCCAGCCCCGCCCAGG - Intronic
1160852031 19:1197300-1197322 GGCTTCTGCCAGCCCCGCCCAGG - Intronic
1160899270 19:1419075-1419097 GACACAGCCCGGCCCAGCCCCGG - Intronic
1161007889 19:1945409-1945431 GCCCCCTGCCAGCCCTGCCCAGG + Intronic
1161152668 19:2717829-2717851 GGCACCAGCCCTCCCGGCCCCGG - Exonic
1161401589 19:4067952-4067974 CGCACCAGCCAGCCCTCCCCGGG - Intergenic
1162154061 19:8664685-8664707 GGCCCTGGGCAGCCCAGCCCAGG - Intergenic
1163185498 19:15636251-15636273 GGCACCAGCCAGGGCAGCCAAGG - Intronic
1163432913 19:17278904-17278926 GGCACTGGCTGGGCCAGCCCTGG + Exonic
1163439379 19:17313966-17313988 GGCAAGGGCCAGCTCATCCCTGG - Intronic
1163711577 19:18850308-18850330 GGCCCAGCCCAGCCCAGCCGTGG + Intronic
1163906098 19:20150754-20150776 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1164620723 19:29694706-29694728 GGTCCCGGCCAGGCCAGGCCAGG - Intergenic
1164876815 19:31696744-31696766 GGCAACCCCCAGGCCAGCCCTGG + Intergenic
1165322395 19:35094100-35094122 TGCCCTGCCCAGCCCAGCCCAGG - Intergenic
1165419501 19:35715953-35715975 GGCCCCGCACAGCTCAGCCCTGG + Exonic
1165750480 19:38256409-38256431 GCCCCCGGCTAGCCCCGCCCTGG - Exonic
1165961649 19:39539869-39539891 GGCGGCGGCCAGGGCAGCCCCGG - Exonic
1166295956 19:41889569-41889591 GACCCCGTCCAGCCCAGCACAGG + Intronic
1166979497 19:46624227-46624249 GGAACCCTCCAGCCCAGACCTGG - Exonic
1167096145 19:47375965-47375987 GGCCGCTGCCAGCTCAGCCCAGG + Exonic
1167138464 19:47632774-47632796 GGCACAGGCCCACCCAGCCTAGG + Intronic
1167146027 19:47681154-47681176 ACCACCCCCCAGCCCAGCCCTGG + Exonic
1167438123 19:49491586-49491608 GGCACCTGCCAGGCCTGTCCAGG - Intronic
1167604651 19:50475389-50475411 GGCAGCCTCCAGTCCAGCCCTGG - Exonic
1167645271 19:50702423-50702445 CCCACAGCCCAGCCCAGCCCAGG + Intronic
1168561718 19:57390071-57390093 GGCCTCCGCCAGCCCAGCCAGGG - Exonic
926038557 2:9654585-9654607 AGCCCAGTCCAGCCCAGCCCAGG + Intergenic
926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG + Exonic
926905964 2:17805937-17805959 TCCACTGGCCAGCCCAGCCCTGG - Intergenic
927047305 2:19292203-19292225 GGCAGCAGCCAAACCAGCCCTGG + Intergenic
928025605 2:27736246-27736268 GGCAGAGGCCAGCTCAGTCCTGG - Intergenic
928127176 2:28625056-28625078 GGGACATGCCAGCCCAGGCCTGG + Exonic
928426050 2:31178726-31178748 CTCACTGGCCAGTCCAGCCCAGG + Intronic
928998629 2:37324487-37324509 GACACCGCCCAGCCCGGCGCGGG + Intronic
929555260 2:42921869-42921891 GGCACTGCCCAGTCCAACCCAGG - Intergenic
929777496 2:44938164-44938186 GTCACCCGCCACCCCAGCACTGG - Intergenic
929876397 2:45800422-45800444 GGCTCCAGCCACTCCAGCCCTGG - Intronic
929982636 2:46696360-46696382 GGCACCCAGCTGCCCAGCCCAGG - Intergenic
931976224 2:67646859-67646881 GGGCCAGGCCAGCCCAGCCCAGG - Intergenic
932219623 2:69989696-69989718 GGCACTGGCCCGCCAACCCCAGG + Intergenic
932567191 2:72917545-72917567 CGCACTGCCCTGCCCAGCCCCGG - Exonic
932618861 2:73254091-73254113 GGCACTGCCCAGCCCCTCCCTGG - Intergenic
932881176 2:75503541-75503563 AGCAGCAGCCAGCCCAGACCAGG + Intronic
933971420 2:87472961-87472983 AGCACAGGCCAGGCCAGGCCAGG + Intergenic
934519071 2:95007876-95007898 GACAGCCGCCAGCCCAGTCCTGG + Intergenic
934561304 2:95314919-95314941 GGCACCCGACAGGGCAGCCCTGG + Intronic
934605056 2:95688500-95688522 TGAACCTCCCAGCCCAGCCCTGG + Intergenic
934728088 2:96638101-96638123 GGCCCCTGCCAGCCCGCCCCCGG + Intronic
936322310 2:111477238-111477260 AGCACAGGCCAGGCCAGGCCAGG - Intergenic
936521611 2:113215331-113215353 AGCACAGGCCAGGCCAGCCCAGG - Intergenic
936538510 2:113331042-113331064 TGAACCTCCCAGCCCAGCCCTGG + Intergenic
937395444 2:121530617-121530639 CGCCCCCGCCAGCCCCGCCCCGG + Intronic
937737683 2:125312475-125312497 GGCTCCCACCAGCCCACCCCGGG - Intergenic
937905706 2:127051812-127051834 GGCCCAGGTCAGCCCAGCTCTGG - Intronic
937919703 2:127120544-127120566 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
937974856 2:127576503-127576525 GCCTCTGCCCAGCCCAGCCCTGG - Intronic
938903384 2:135817372-135817394 GGCACCGGCCAGCACCCTCCCGG - Exonic
939000172 2:136725770-136725792 CACCCCGCCCAGCCCAGCCCAGG - Intergenic
940002035 2:148975932-148975954 AGCAGAGCCCAGCCCAGCCCAGG - Intronic
941905485 2:170714358-170714380 GGCCCCCCACAGCCCAGCCCGGG + Exonic
942302108 2:174572158-174572180 GGCCCCAGGCAGCCCAGCCCCGG - Exonic
944143793 2:196484731-196484753 GGCACCGCCCTCCCCAACCCCGG + Intronic
945049848 2:205813267-205813289 GGCACCTGCCAACCCATGCCTGG + Intergenic
945259584 2:207831332-207831354 GGCTCCTGGCAGCCCAGCCAAGG + Intronic
945950518 2:216034873-216034895 ATCACCGGCCAGCCCAGAACTGG + Intronic
946281334 2:218667933-218667955 GGCAGTGCCCAGCCCAGCCTTGG + Exonic
946393513 2:219430893-219430915 GGCTCTGGCCAGGCCAGGCCAGG - Intergenic
946401164 2:219469085-219469107 GTGAGGGGCCAGCCCAGCCCTGG + Intronic
946407018 2:219497221-219497243 GGTCCCCGCCAGCCCAGCTCTGG + Intronic
946418716 2:219553066-219553088 GGCACAGGCGACCCCGGCCCTGG + Intronic
947224431 2:227826333-227826355 GGCAAGGGCAAGCCCTGCCCTGG - Intergenic
947745037 2:232503097-232503119 CGCAGCGGCCAGGCCCGCCCCGG - Intergenic
948280464 2:236743337-236743359 GGGTCCTGCCAGCCCACCCCTGG - Intergenic
948567830 2:238897765-238897787 GGCACTGCCCATCCCAGCCCGGG + Intronic
948570550 2:238914689-238914711 GGCAGCCCCGAGCCCAGCCCAGG - Intergenic
948591416 2:239053229-239053251 CCCACCCGCCAGCCTAGCCCTGG + Intronic
948753152 2:240144018-240144040 GGCACAGGCCCGGCCACCCCAGG - Intronic
948792313 2:240385443-240385465 AGCCCAGCCCAGCCCAGCCCAGG - Intergenic
948792332 2:240385518-240385540 AGCACAGCCCAGCCCAGCCCAGG - Intergenic
948792459 2:240386054-240386076 AGCACAGCCCAGCCCAGCCCAGG - Intergenic
948888035 2:240893557-240893579 GGAACCGGTGAGACCAGCCCGGG - Intronic
948908956 2:240993584-240993606 GGGACCCGACAGCCCAGGCCAGG + Intergenic
1170578373 20:17681257-17681279 GGCTCCGCGCAGCCCAGCCGGGG + Intronic
1170873890 20:20233168-20233190 GGCAGCAGCCAGCCTAGCGCTGG + Intronic
1171145184 20:22775065-22775087 GGGACCTGCCAGCCCAGCTTGGG + Intergenic
1171461858 20:25302498-25302520 GGCTCCTCCCAGCCCACCCCCGG - Intronic
1172028923 20:31968202-31968224 GGCCTCGGCCAGCCCGGACCCGG + Exonic
1172181890 20:33008556-33008578 GGCAGCGGCCAGGGCAGCCATGG + Exonic
1172445435 20:34990834-34990856 GGCCCCAGCCAGGCCAGCCCTGG - Intronic
1172528583 20:35616110-35616132 GGCTCCGGTCAGCGGAGCCCGGG + Exonic
1172600599 20:36180073-36180095 AGCCCCTGCCAGCACAGCCCAGG + Intronic
1173162744 20:40664394-40664416 GGGACAGGCCAGGCCAGGCCAGG - Intergenic
1173184298 20:40829045-40829067 GCCATCAGCCATCCCAGCCCAGG + Intergenic
1173221795 20:41137595-41137617 GGCACAGGCCAGGACCGCCCGGG - Exonic
1173517275 20:43673715-43673737 GGCAGCGGCCAGCCCACCCTAGG - Intronic
1174307633 20:49625648-49625670 GCCACCGTGCCGCCCAGCCCAGG + Intergenic
1174370399 20:50083201-50083223 GGCAGCCGCCAGCCCAGCAGCGG - Intronic
1174479685 20:50822117-50822139 AGCCCCAACCAGCCCAGCCCAGG - Intronic
1174587325 20:51619130-51619152 GACAACGGCCACCCCAGCCAAGG + Intronic
1175111415 20:56650840-56650862 AGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1175161813 20:57013874-57013896 GCCACCGGCCCGCGCAGTCCGGG + Intergenic
1175787920 20:61723660-61723682 TGCACCGCACAGCCCTGCCCAGG - Intronic
1175874329 20:62222219-62222241 GGCTCAGGCCAGCACTGCCCAGG - Intergenic
1175891887 20:62319334-62319356 AGGACCTGCCAGCCCAGCCTGGG - Intronic
1175894319 20:62329372-62329394 AGCCCAGCCCAGCCCAGCCCTGG + Intronic
1175911354 20:62406884-62406906 GGGCCCGGCCAGGTCAGCCCAGG - Intronic
1176110690 20:63409463-63409485 GGCCCCTGCCAGCCCAGCAGTGG - Intronic
1176114889 20:63427882-63427904 TGCACCTGCCAGGCCTGCCCAGG - Intronic
1176553642 21:8243093-8243115 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1176572564 21:8426117-8426139 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1176580473 21:8470678-8470700 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1178944611 21:36936543-36936565 GGCCCCGTCCGGCTCAGCCCCGG - Exonic
1179149671 21:38799132-38799154 GGCACTGGGCAGCCCATCACAGG - Intergenic
1179174718 21:39000185-39000207 GGCACCGGGTGGCACAGCCCAGG + Intergenic
1179218826 21:39388921-39388943 GGGACCAGCCAGGCCAGCCTGGG + Intronic
1179430445 21:41317331-41317353 GGCAGCGGCCAGCCCCTCCCTGG - Intronic
1179492234 21:41748137-41748159 GACACCGGCCAGCAGAGGCCTGG + Intronic
1179728492 21:43354113-43354135 GCCTCAGGCCAGCACAGCCCTGG + Intergenic
1179888303 21:44323933-44323955 GACACCGGCCTGCCATGCCCAGG + Intronic
1180043871 21:45293941-45293963 GGCACCGGCCAGTCTCACCCAGG - Intergenic
1180079848 21:45481694-45481716 AGCAGCGGCTACCCCAGCCCTGG + Intronic
1180135600 21:45859974-45859996 GGCACCGGCCATCCCTGGGCTGG - Intronic
1180180346 21:46116111-46116133 GGCTCCCCCCAGCCCAGCCTCGG + Intronic
1180341737 22:11625820-11625842 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1180761940 22:18217212-18217234 GGCACAGTCCAGCCCATCCTGGG + Intergenic
1180773727 22:18407398-18407420 GGCACAGTCCAGCCCATCCTGGG - Intergenic
1180805078 22:18656942-18656964 GGCACAGTCCAGCCCATCCTGGG - Intergenic
1180805667 22:18712466-18712488 GGCACAGTCCAGCCCATCCTGGG + Intergenic
1181029871 22:20144535-20144557 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
1181069785 22:20326115-20326137 GGCACAGTCCAGCCCATCCTGGG - Intergenic
1181192828 22:21154323-21154345 GGCACAGTCCAGCCCATCCTGGG - Intergenic
1181216614 22:21338251-21338273 GGCACAGTCCAGCCCATCCTGGG + Intergenic
1181269781 22:21652360-21652382 AGGGCCGCCCAGCCCAGCCCAGG - Intronic
1181513396 22:23398772-23398794 AGCCCCGCCCAGCCCAGCCCAGG - Intergenic
1181559229 22:23690323-23690345 AGCTACGGCCATCCCAGCCCTGG - Intronic
1181697605 22:24601780-24601802 GGCAGCTGCCAACACAGCCCGGG - Intronic
1182054194 22:27337043-27337065 GCCAACAGCCAGCCAAGCCCTGG - Intergenic
1182241666 22:28920962-28920984 GGAACCTGCCAGCCTGGCCCTGG - Intronic
1182445457 22:30387143-30387165 GGCTCCGCCCCGCCCCGCCCCGG + Exonic
1182916867 22:34041613-34041635 AGCCCAGCCCAGCCCAGCCCAGG + Intergenic
1183323932 22:37181181-37181203 GTGACTGGCCAGTCCAGCCCAGG - Exonic
1183407877 22:37639433-37639455 CGCAGCGCCCCGCCCAGCCCCGG - Intronic
1183697441 22:39431223-39431245 GGGTCGGGCCAGCCCAGCCCAGG + Exonic
1183714401 22:39525328-39525350 GGCCTTGGCCAGCCCAGCCTAGG + Intergenic
1183823045 22:40362577-40362599 CAGACTGGCCAGCCCAGCCCTGG + Intronic
1183845094 22:40536394-40536416 GGCGCCGGCGAGCGCCGCCCGGG + Intronic
1183980942 22:41539759-41539781 GAGATGGGCCAGCCCAGCCCAGG + Intronic
1184246567 22:43238737-43238759 GCCCCCGTTCAGCCCAGCCCTGG + Intronic
1184265226 22:43342940-43342962 GGCCCCGGCCCACCCACCCCTGG + Intronic
1184287015 22:43477529-43477551 GGCACCAACCAGGGCAGCCCAGG - Intronic
1184411868 22:44330802-44330824 GGGCCGGGCCACCCCAGCCCCGG + Intergenic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
1184756600 22:46519600-46519622 GGCACCTCCCAACCCCGCCCAGG - Intronic
1184847190 22:47095888-47095910 GCCAGCCTCCAGCCCAGCCCTGG - Intronic
1184974578 22:48051976-48051998 CGCCCCGGCCAGGCCAGCCCAGG + Intergenic
1185044927 22:48523996-48524018 ATCACAGGCCAGCCCGGCCCCGG - Intronic
1185052895 22:48563008-48563030 GGCTCGGTCCAGCCCAGCTCTGG - Intronic
1185237796 22:49724901-49724923 AGCCCCGGCCACCCCACCCCTGG + Intergenic
1185279717 22:49964837-49964859 GGCACCCCACAGCCCAGCACAGG - Intergenic
1203235559 22_KI270731v1_random:148372-148394 GGCACAGTCCAGCCCATCCTGGG - Intergenic
1203258644 22_KI270733v1_random:160125-160147 GGCTCCGGCCCGGCCAGCCCCGG + Intergenic
949522361 3:4868642-4868664 GGCACTTCCCAGCCCAGCCCGGG + Intronic
950431584 3:12954128-12954150 GGCTCCAGCCTCCCCAGCCCAGG + Intronic
951472322 3:23069968-23069990 TGCCCAGCCCAGCCCAGCCCAGG + Intergenic
952809107 3:37385583-37385605 GGCACTGTCCACCCCAGCCATGG + Intergenic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
953782057 3:45880090-45880112 GGCCTAGGCCAGCCCAGCCAAGG + Intronic
954035338 3:47848230-47848252 GGCAGCGGCCCGCCCGGCCCCGG - Exonic
954197771 3:49006639-49006661 AGCTCTGGCCAGCCCAGCCTAGG + Intronic
954373941 3:50184535-50184557 GGCTCCAGCCTGCCCTGCCCAGG + Intronic
954396021 3:50293744-50293766 GGATCTGGCCAGCCCAGCACTGG - Intronic
954465403 3:50651553-50651575 GCCAGCCGCTAGCCCAGCCCAGG + Intergenic
954632832 3:52056391-52056413 GGGGCCGGGCAGCCCTGCCCTGG + Exonic
954781587 3:53066023-53066045 GGTAGCAGCCAGCCCAGCCAGGG - Intronic
954817516 3:53294411-53294433 TGGGCAGGCCAGCCCAGCCCAGG + Intronic
954934836 3:54317247-54317269 GGCTCTGGCCAGCCCAAACCTGG - Intronic
956746750 3:72316719-72316741 GGCTCCATCCACCCCAGCCCCGG + Intergenic
959920109 3:111859939-111859961 GGCACTGCCGACCCCAGCCCGGG - Intronic
961444683 3:126973721-126973743 GGGACCAGGCAGCCCAGCCCAGG + Intergenic
961528338 3:127523439-127523461 TGCACTGGCCATCCCATCCCAGG - Intergenic
962370010 3:134813526-134813548 AGCACCCCCTAGCCCAGCCCTGG + Intronic
962731779 3:138290176-138290198 GGCCCTGGCCAGACCAGGCCAGG - Intronic
962755079 3:138460420-138460442 GCCACCCCCCAGCCCAGCTCAGG - Intronic
964296675 3:155240798-155240820 GGGAGCAGACAGCCCAGCCCAGG - Intergenic
968441530 4:626862-626884 GGCAGCGGCCAGCAGAGACCTGG + Intronic
968658696 4:1789823-1789845 GGCCCGGCCCAGCCCAGCCCTGG - Intergenic
968702827 4:2064820-2064842 GACACCAGTCAGCACAGCCCAGG - Exonic
968831101 4:2933439-2933461 GGCACCAGACATGCCAGCCCAGG + Intronic
969343291 4:6555900-6555922 GGCAGTGGCCAGCTCAGCCCTGG + Intronic
970421078 4:15906119-15906141 GCCAGAGGCCAGCCCCGCCCGGG - Intergenic
972694606 4:41433496-41433518 TGGACCTTCCAGCCCAGCCCCGG - Intronic
974251285 4:59388262-59388284 GCAACCAGCCAGCCAAGCCCAGG + Intergenic
975848936 4:78551973-78551995 GCCAGCCGCCAGCCCTGCCCAGG - Intronic
976256999 4:83109816-83109838 GCCTCCCGCCAGCCCAGCTCTGG + Intronic
983936199 4:173504346-173504368 GGTACCTGCCAGCACAGCCTGGG + Intergenic
985497605 5:218437-218459 GGCCCCCGCCTGCCCCGCCCCGG - Intronic
985548650 5:522358-522380 GGCACCAGCCAGCCCCGCCTGGG - Intronic
985737717 5:1594354-1594376 GGCCCCCGCCTGCCCCGCCCCGG + Intergenic
985774282 5:1832711-1832733 TGCAGGGGCCTGCCCAGCCCAGG + Intergenic
985811668 5:2094732-2094754 GGAGGCGGCCAGGCCAGCCCTGG + Intergenic
986304770 5:6506982-6507004 TGCACAGCCCAGCCCAGCCCAGG + Intergenic
988035635 5:25823731-25823753 GGCATCGGCCAGCCCAGAGTGGG + Intergenic
988781852 5:34529574-34529596 AGCACCTCCCAGCCCAGCCCAGG + Intergenic
990527097 5:56638771-56638793 GGCACTTCCCAGCACAGCCCGGG - Intergenic
992080589 5:73232395-73232417 GCCACCTCCCTGCCCAGCCCCGG + Intergenic
995073063 5:107947336-107947358 GGCACCTCCCAGCCCAGGCAAGG - Intronic
996023285 5:118615298-118615320 AGCCCTGCCCAGCCCAGCCCAGG + Intergenic
997206516 5:132053529-132053551 GGCAGTGGGCATCCCAGCCCAGG + Intergenic
997241576 5:132311985-132312007 GGCACAGGCCAGTCAAACCCAGG + Intronic
997511687 5:134458869-134458891 GGCATAGAACAGCCCAGCCCTGG - Intergenic
998039689 5:138944462-138944484 GGCCCGGGTCAGCCCAGCCCAGG + Intergenic
998158304 5:139798382-139798404 CCCACAGGCCAGCCCAGGCCAGG - Intronic
998232119 5:140367429-140367451 GACACCAGCCAGCCACGCCCAGG - Exonic
999202603 5:149826819-149826841 TGCACCCCCCAGCCCTGCCCCGG + Exonic
999322563 5:150624607-150624629 CGCCCCGCCCCGCCCAGCCCTGG - Intronic
999327401 5:150651586-150651608 AGCCCAGCCCAGCCCAGCCCAGG - Exonic
1000034471 5:157434180-157434202 GGAACCGGCCAGAAAAGCCCAGG + Intronic
1001705304 5:173737203-173737225 GACACCTGCCAGCCCCACCCTGG + Intergenic
1001768177 5:174271508-174271530 GGCACCTCCCAGCCCAGCTGGGG + Intergenic
1003525466 6:6893140-6893162 TTTACTGGCCAGCCCAGCCCAGG - Intergenic
1003979826 6:11379120-11379142 GGCACAGGCCAGGCAGGCCCTGG + Intronic
1004396160 6:15248253-15248275 CGCGCCCGCCCGCCCAGCCCCGG - Intronic
1006054255 6:31369420-31369442 GGCAGCTGCCAGCTCAGCCTTGG - Intergenic
1006116154 6:31777124-31777146 AGCCCGGGCCAGCCCTGCCCAGG - Exonic
1006419493 6:33924417-33924439 GGCACCACCAATCCCAGCCCTGG + Intergenic
1006496373 6:34426141-34426163 GGCACCGCCGAGGCCACCCCAGG - Intergenic
1006926470 6:37658197-37658219 GGGCCCTGACAGCCCAGCCCGGG - Intronic
1007079213 6:39086820-39086842 GCCACCGGGGAACCCAGCCCTGG + Exonic
1007367581 6:41405923-41405945 GGCCACTGCCAGCCCTGCCCAGG + Intergenic
1007383221 6:41503899-41503921 GGCACCCGCTCGCCCTGCCCGGG + Intergenic
1013987361 6:116211200-116211222 CGTTCCAGCCAGCCCAGCCCAGG + Intronic
1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG + Intergenic
1016992895 6:149942140-149942162 CTCACCGGCTCGCCCAGCCCGGG - Exonic
1017913897 6:158818261-158818283 AGAACCGGCCAGCCCGGGCCCGG + Intronic
1018085832 6:160300475-160300497 GGCAGGGGCCAGCCCAGCAAAGG + Intergenic
1018710500 6:166495271-166495293 GGCAACAGCCAGCCCTGCCTCGG + Intronic
1018961939 6:168455428-168455450 GCCAGCTGCCAGGCCAGCCCGGG - Intronic
1019174063 6:170150988-170151010 GTCTCAGGCCCGCCCAGCCCTGG + Intergenic
1019275292 7:172833-172855 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275353 7:172983-173005 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275366 7:173013-173035 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275379 7:173043-173065 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275390 7:173073-173095 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019291583 7:253074-253096 AGGACCGCCCTGCCCAGCCCAGG - Intronic
1019354532 7:571789-571811 GGCACCGCCCCACCCAGCCCCGG + Intronic
1019418104 7:936561-936583 GGGAGCGTCCAGCCCCGCCCTGG + Intronic
1019486939 7:1293677-1293699 GGGACGGGGAAGCCCAGCCCGGG - Intergenic
1019496176 7:1341599-1341621 GCCACAGGTCAGCCCAGCGCGGG + Intergenic
1019504732 7:1385254-1385276 CGCCCCGGCCTGCCCTGCCCCGG - Intergenic
1019568004 7:1694212-1694234 GGCACCGGCCTCCCAAGCCTGGG - Exonic
1020078449 7:5273978-5274000 AGCGCCGGCCTGCCCAGCACCGG - Intergenic
1022008844 7:26291830-26291852 GCCTCCGCGCAGCCCAGCCCAGG - Intergenic
1022097954 7:27152467-27152489 AGCCCCGGCCAGGCCAGGCCTGG - Intronic
1022112397 7:27239658-27239680 GGGCCAGGCCAGCCCAGCCCCGG + Intergenic
1023861451 7:44219771-44219793 GGCCCCGGGCAGCACAGTCCTGG - Intronic
1023967369 7:44969949-44969971 GCCACCTGTCAGGCCAGCCCGGG + Intronic
1024240096 7:47428164-47428186 GGCACTGACCAACCCAGCACTGG + Intronic
1024965610 7:55019958-55019980 GGCGCCCGCCAGCCTGGCCCCGG + Intronic
1024991037 7:55234626-55234648 GGCACGGGGCAGCCCAGGCAGGG + Intronic
1025671502 7:63618717-63618739 AGCACCCGCCTGCCCAGCACCGG - Intergenic
1027188864 7:75986660-75986682 GGCCCCTGGCAGCACAGCCCAGG + Exonic
1029363019 7:100100841-100100863 GGCCCCGGCCTGCCCGCCCCCGG + Intronic
1029465818 7:100723932-100723954 GGCAGCTGCCAACCCTGCCCAGG + Intergenic
1029849344 7:103446101-103446123 GGCTCCGCCCAGGGCAGCCCGGG - Exonic
1032020466 7:128404976-128404998 GTCTCCTGCCAGCCCTGCCCTGG - Intronic
1032196881 7:129794551-129794573 CGGACCGGCCAGCACTGCCCTGG - Intergenic
1032439688 7:131933025-131933047 GGCAGAGGACAGCCCAGCACAGG - Intergenic
1032662593 7:134001770-134001792 GGCACAGGCCAGGTCAGCACAGG - Intronic
1034497650 7:151431995-151432017 GGCAGTGGGCATCCCAGCCCTGG - Intronic
1034534621 7:151719255-151719277 GGCCCCGGCACGCTCAGCCCTGG + Intronic
1034885238 7:154793997-154794019 GGGACCGCCGACCCCAGCCCTGG - Intronic
1035187715 7:157139167-157139189 GGCGCCCGCCCGCCCGGCCCGGG - Exonic
1035283495 7:157792313-157792335 TACTCAGGCCAGCCCAGCCCTGG + Intronic
1035298097 7:157878211-157878233 AGCACTGGCCGGCCCAGCACGGG - Intronic
1035765377 8:2100802-2100824 CCCACCGCCCAACCCAGCCCCGG - Intronic
1036033362 8:4994646-4994668 GGCCCCGGCCCCGCCAGCCCGGG - Exonic
1037959320 8:23084283-23084305 TGCTCAGCCCAGCCCAGCCCAGG - Intergenic
1038492672 8:27981902-27981924 GGCCCCAGCCAGCCCCTCCCAGG + Intronic
1038699369 8:29835545-29835567 GGAACAGCCCAGCCCAGCACAGG - Intergenic
1039984575 8:42436720-42436742 GTCACCGGCCAGCCCTTCCCTGG + Intronic
1040078089 8:43260386-43260408 TGCACAGGGCAGCACAGCCCTGG + Intergenic
1041670954 8:60491523-60491545 TGCTCCAGCCAACCCAGCCCAGG + Intergenic
1045098816 8:98825605-98825627 GGCACCGGCCGGCCGAGCCTAGG + Intronic
1048009358 8:130443609-130443631 GGCAGCGGCCAGGCCAGGCGAGG + Exonic
1048293929 8:133200500-133200522 GCCACCGCCAAGCCCAGGCCTGG + Intronic
1048550895 8:135432903-135432925 AGCACCAGGCAGCCCAGCCTTGG + Intergenic
1049240948 8:141537094-141537116 TGCACCGCCCAGGCCAGCCCAGG - Intergenic
1049519438 8:143080570-143080592 GGGACCGGCCAGCCCCTCCTCGG - Exonic
1049601248 8:143508758-143508780 GACCCCACCCAGCCCAGCCCAGG + Intronic
1049765735 8:144354472-144354494 AGCACCGGCCGGCCCCACCCAGG + Intronic
1049782462 8:144435227-144435249 GGGACCCGCCATCCCTGCCCAGG + Intronic
1049788797 8:144463580-144463602 GCCACCTGCCAGGCCAGGCCAGG + Intronic
1049800295 8:144514549-144514571 GTCATACGCCAGCCCAGCCCTGG + Intronic
1054764975 9:69035821-69035843 GGCGTCACCCAGCCCAGCCCAGG + Exonic
1054781959 9:69174087-69174109 GGCGCCGGCGAGCCCTTCCCCGG + Intronic
1055494484 9:76841139-76841161 GGGACTGGTCAGCCCAGCCATGG + Intronic
1056369721 9:85941548-85941570 GGGTCAGCCCAGCCCAGCCCCGG - Intronic
1056643310 9:88388715-88388737 GGCCCAGGCCCGCCCAGCCCGGG - Intronic
1057134853 9:92680483-92680505 GGCAAGGGCCAGCCCACACCAGG + Intergenic
1057172391 9:92970836-92970858 GGCAGTGGCCACACCAGCCCAGG + Intronic
1057259777 9:93577009-93577031 GGCACGGCCCAGCCCCGACCGGG - Intronic
1057272697 9:93659697-93659719 GGCACTGGCCTTCCCAGACCTGG - Intronic
1057571058 9:96204398-96204420 GGCCCAGGCCTGCCTAGCCCTGG - Intergenic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1057911120 9:99021290-99021312 GACACCGCCCTCCCCAGCCCTGG - Intronic
1058434668 9:104951367-104951389 GGCTCAGGCCACTCCAGCCCGGG + Intergenic
1060182873 9:121546089-121546111 GTCCTCGGCCAGCTCAGCCCAGG + Intergenic
1060321495 9:122565499-122565521 GGCAGTGGCCAGGTCAGCCCTGG - Intergenic
1060778455 9:126393775-126393797 GGCCCCTGCCAGCCCTGGCCAGG - Intronic
1060785597 9:126449615-126449637 GGCCCAGGCCAGCCCTGTCCAGG - Intronic
1060812023 9:126615329-126615351 AGCGCCGCCCGGCCCAGCCCCGG - Intronic
1061108851 9:128552734-128552756 GGCCCCGGGCAGCCGACCCCCGG + Intronic
1061386987 9:130296195-130296217 GGCAGCAGCCTGCCCATCCCAGG - Intronic
1061480522 9:130895747-130895769 AGCTCTGCCCAGCCCAGCCCCGG - Intergenic
1061875244 9:133540277-133540299 GGCCCTGGGCACCCCAGCCCTGG - Intronic
1061922743 9:133791148-133791170 GGCTCCGGTCAGCACAGACCAGG + Intronic
1062030633 9:134360375-134360397 GGCGTCGGCAAGCCCAGGCCTGG - Intronic
1062106241 9:134756576-134756598 GGCACAGAACAGCCCCGCCCGGG + Intronic
1062127393 9:134870913-134870935 GGCACCGCCGAGCCCAGTGCTGG - Intergenic
1062190746 9:135246709-135246731 GGCTCCAGCCAGGCCAGCCCAGG - Intergenic
1062332274 9:136049960-136049982 GCCGCCGGCCGGCCCAGGCCTGG - Exonic
1062384534 9:136303944-136303966 GGCAGTGGCCAGCCCATCCCGGG - Exonic
1062527371 9:136983379-136983401 GGCCCCCACCAGCCCAGCACCGG - Exonic
1062550954 9:137086364-137086386 GGTAGCAGCCACCCCAGCCCGGG + Intergenic
1062601706 9:137321294-137321316 GGCCCCTCCCTGCCCAGCCCAGG + Intronic
1062602400 9:137323826-137323848 GGCAGCGCCCAGCCCCGACCTGG + Exonic
1203474834 Un_GL000220v1:142136-142158 GGCTCCGGCCCGGCCAGCCCCGG + Intergenic
1185445092 X:253698-253720 GGCAGGGGCCTTCCCAGCCCTGG - Intergenic
1185493732 X:538551-538573 TCCACCGACCAGACCAGCCCGGG - Intergenic
1185519466 X:728013-728035 TGCAGCGTCCAGCTCAGCCCAGG - Intergenic
1187873507 X:23783590-23783612 GGCTCCGGCCCGGCCAGCTCAGG - Intronic
1187976708 X:24710095-24710117 GGCGCCGGCGAGCGCCGCCCGGG - Intronic
1189331262 X:40146251-40146273 GGCACCGGGCTCCCCAGCCCCGG - Intronic
1191880380 X:65839221-65839243 GGCACAGGTCAAGCCAGCCCAGG - Intergenic
1194885801 X:99314623-99314645 GGCATCAGCCATCCCTGCCCTGG - Intergenic
1196404627 X:115348295-115348317 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1200058348 X:153473026-153473048 AGCACCCGCCAGCCCATCTCTGG - Intronic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic
1201048452 Y:9909131-9909153 TGCACAGCCCAGCCCATCCCCGG - Intergenic