ID: 901320264

View in Genome Browser
Species Human (GRCh38)
Location 1:8335705-8335727
Sequence GCCCCCAACAACAGCACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 122}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901320261_901320264 -6 Left 901320261 1:8335688-8335710 CCTTTCTGAGTTCACCAGCCCCC 0: 1
1: 0
2: 2
3: 14
4: 200
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320251_901320264 26 Left 901320251 1:8335656-8335678 CCCAGGATGCCCCTGAGCCTCCC 0: 1
1: 0
2: 6
3: 29
4: 363
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320252_901320264 25 Left 901320252 1:8335657-8335679 CCAGGATGCCCCTGAGCCTCCCT 0: 1
1: 0
2: 5
3: 40
4: 388
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320256_901320264 9 Left 901320256 1:8335673-8335695 CCTCCCTTCCCAGAACCTTTCTG 0: 1
1: 0
2: 3
3: 39
4: 370
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320259_901320264 1 Left 901320259 1:8335681-8335703 CCCAGAACCTTTCTGAGTTCACC 0: 1
1: 0
2: 2
3: 19
4: 215
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320257_901320264 6 Left 901320257 1:8335676-8335698 CCCTTCCCAGAACCTTTCTGAGT 0: 1
1: 0
2: 1
3: 23
4: 270
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320250_901320264 29 Left 901320250 1:8335653-8335675 CCTCCCAGGATGCCCCTGAGCCT 0: 1
1: 0
2: 6
3: 36
4: 303
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320253_901320264 17 Left 901320253 1:8335665-8335687 CCCCTGAGCCTCCCTTCCCAGAA 0: 1
1: 1
2: 2
3: 44
4: 430
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320255_901320264 15 Left 901320255 1:8335667-8335689 CCTGAGCCTCCCTTCCCAGAACC 0: 1
1: 0
2: 0
3: 61
4: 515
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320260_901320264 0 Left 901320260 1:8335682-8335704 CCAGAACCTTTCTGAGTTCACCA 0: 1
1: 0
2: 1
3: 16
4: 202
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320254_901320264 16 Left 901320254 1:8335666-8335688 CCCTGAGCCTCCCTTCCCAGAAC 0: 1
1: 0
2: 2
3: 40
4: 408
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122
901320258_901320264 5 Left 901320258 1:8335677-8335699 CCTTCCCAGAACCTTTCTGAGTT 0: 1
1: 0
2: 0
3: 36
4: 301
Right 901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901320264 Original CRISPR GCCCCCAACAACAGCACCAA GGG Intronic
901145476 1:7061836-7061858 GCACCAAACACCAGCCCCAAGGG - Intronic
901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG + Intronic
902408353 1:16198759-16198781 GCCAAGAACAACAGCATCAAAGG + Intronic
903461940 1:23526422-23526444 TCCCCCAGCAGGAGCACCAAGGG + Intronic
904664325 1:32108325-32108347 GTCCCCGAAACCAGCACCAAAGG - Intronic
906339346 1:44964947-44964969 GCACACAAAAACAGCACCAATGG + Intronic
908395921 1:63725618-63725640 TATCCCAAGAACAGCACCAACGG + Intergenic
908580599 1:65512205-65512227 TACCACAAGAACAGCACCAAGGG + Intronic
912616995 1:111112236-111112258 TCTCACAAGAACAGCACCAAAGG - Intergenic
913088994 1:115463446-115463468 CCCCCTATCAACAGCACCAAGGG + Intergenic
915121762 1:153633869-153633891 CGCCCCAACAACAGGACCATTGG + Intronic
917146772 1:171900549-171900571 GCCCTCACCAAGATCACCAATGG - Intronic
918894280 1:190319704-190319726 TATCACAACAACAGCACCAAGGG + Intronic
921756084 1:218857131-218857153 GTCACCAAAATCAGCACCAAGGG - Intergenic
923296647 1:232601038-232601060 GGCACCAACAACAGCCCCGATGG + Intergenic
923338511 1:232989542-232989564 GCCCCCAACCACCTCTCCAATGG + Intronic
1067728253 10:48789956-48789978 ACCCACAGCAACAGCTCCAATGG - Exonic
1068497218 10:57798078-57798100 GCACACAACAAAAGCACCATAGG + Intergenic
1071265391 10:83960244-83960266 GCCCCCAACAGTGGCATCAAAGG + Intergenic
1073095547 10:100977525-100977547 GCCCCCACCCACAGGACAAACGG - Intronic
1076301904 10:129434601-129434623 CCCCCCAACAACGGTACCAGCGG + Intergenic
1077128787 11:958624-958646 GCTCCCACCAACAGCCCCAAAGG - Intronic
1077215398 11:1393371-1393393 GCCCCCAAGAACAGCTCCAAGGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1081983603 11:47285542-47285564 GTCTCCAACACCAGCACCGAGGG + Exonic
1083592722 11:63904823-63904845 GCCCACAACATCAGCAGCAGTGG + Exonic
1085260668 11:75202985-75203007 GACCCCATCACCACCACCAATGG - Intronic
1085955564 11:81389480-81389502 GGCCCCAACAACAGGAGTAAGGG + Intergenic
1086727545 11:90206787-90206809 GCCTCCATCTACAGCAGCAATGG - Intronic
1087621406 11:100547085-100547107 TCTCACAACAACAGCACCCAGGG - Intergenic
1090443703 11:126745695-126745717 GCTCTCACCTACAGCACCAAGGG - Intronic
1099898883 12:88682425-88682447 TCCCACAAGAACAGCACCAAAGG - Intergenic
1100709080 12:97234918-97234940 GATCACAAGAACAGCACCAATGG + Intergenic
1104127053 12:125857841-125857863 TCTCGCAAGAACAGCACCAAGGG - Intergenic
1113226467 13:108165031-108165053 GCCCCCAGCCACAACACTAAAGG + Intergenic
1118179621 14:63479281-63479303 TCCCCCACCCACAGCACCATGGG - Intronic
1118331670 14:64820252-64820274 GGCCCCAACAACAGTACTGAAGG + Intronic
1118810050 14:69266694-69266716 GCTCCCAACAGCAGCAGGAAAGG + Intronic
1119226734 14:72950170-72950192 TCCCCCAACAATGCCACCAAAGG - Intronic
1120416378 14:84223108-84223130 GACCCAAACAAGATCACCAATGG + Intergenic
1120900841 14:89574244-89574266 GCAGCCAACATCAGCAACAAGGG + Intronic
1125882576 15:43207252-43207274 GGCAACAACATCAGCACCAAGGG - Exonic
1128163394 15:65439780-65439802 GCTCCCCACAAAAGCACCAAGGG + Intergenic
1129482186 15:75835843-75835865 GCCCCCATCATCAGCATCACTGG + Intergenic
1129744250 15:78007243-78007265 GCCCCAGACAACAGCAGCAGAGG + Intronic
1130621150 15:85463822-85463844 GCCACCAGCAACATCACCCAGGG - Intronic
1132924581 16:2422342-2422364 GTCCACAACACCAGCAGCAAGGG + Intergenic
1133370676 16:5243489-5243511 GCCCCCACCAGCACCACGAATGG - Intergenic
1137575005 16:49593730-49593752 GCCCCCAAGACCAGCACCGCTGG + Intronic
1139777146 16:69323625-69323647 ACCCCCAACACCAGCCACAAGGG - Intronic
1141642705 16:85350548-85350570 GCCCCCACCATCTGCACCCAAGG + Intergenic
1148839920 17:50488365-50488387 GTCCCCAACTTCATCACCAAAGG - Intergenic
1151215315 17:72573042-72573064 CCCCCCAACATCAGCCCCAAGGG - Intergenic
1151246117 17:72796314-72796336 ACTCCCATCAACAGCACCCAGGG + Intronic
1152863733 17:82710239-82710261 GCCACCAACAACTGCAGCACCGG - Intergenic
1155152710 18:23135580-23135602 GCCCCCATCCCCAGCACCGAGGG + Intronic
1156594524 18:38532891-38532913 GCCACCTAGCACAGCACCAAGGG + Intergenic
1157159442 18:45299909-45299931 GCCACAAGCATCAGCACCAATGG - Intronic
1159004851 18:63002628-63002650 GTCAACAAAAACAGCACCAAGGG - Intergenic
1159795823 18:72841881-72841903 GCCAGCAACAACTACACCAAGGG + Intronic
1161616636 19:5274513-5274535 GCCCCCCACCACGGCACCCATGG + Intronic
1161967388 19:7555974-7555996 ACCCCCAACGAGAGCACCCAGGG + Intronic
1162791533 19:13065534-13065556 ACCCCCAGCCACAGCAGCAATGG - Intronic
1163377889 19:16944868-16944890 GCCCCTAACAGCAGCCCGAAGGG - Intronic
1166770762 19:45280623-45280645 GCGCCCAGCGACACCACCAACGG + Exonic
927424254 2:22963447-22963469 GGCCCCAACAACAGCAGCTTAGG + Intergenic
928301358 2:30128036-30128058 GCCCCCAAAAACAGAATCAGAGG - Intergenic
928636876 2:33255928-33255950 GCCTCCAACACCAACACCAAAGG + Intronic
930526933 2:52542277-52542299 CCCACCCACAACAGCAGCAACGG + Intergenic
932137671 2:69245150-69245172 GCCGCCCACCACAGCACCACAGG + Intronic
933702160 2:85263289-85263311 ACCCCCAACAAAAGCTCCAGCGG - Intronic
936757064 2:115727120-115727142 AGCCCCAACAACAGGAACAATGG - Intronic
938092218 2:128441292-128441314 GCCCCGAGGACCAGCACCAAGGG - Intergenic
946417513 2:219547784-219547806 CCCCCCAGCAACAGCCCCAGTGG - Exonic
948423120 2:237872543-237872565 GACCCCAACACCTGCCCCAAAGG - Intronic
949018748 2:241728603-241728625 GTCCCCAGCAGCAGCACCTAGGG - Exonic
1168868468 20:1108841-1108863 GCCTCCAACAGCATCACTAAGGG - Intergenic
1174611533 20:51801821-51801843 GCCTCCAAGAAAAGCCCCAAGGG + Intronic
1178372389 21:32037314-32037336 GCGCACAATAGCAGCACCAAGGG + Intronic
1178537210 21:33420287-33420309 TCCCCCTACAACAGCAACTATGG - Intronic
1179821393 21:43939313-43939335 GCCCCCGACAACAACAGCGACGG - Intronic
1180014151 21:45072105-45072127 CTCCCCGACATCAGCACCAAGGG + Intergenic
1180259961 21:46662176-46662198 CCCTCCGACAACAGCCCCAACGG + Intronic
1182685971 22:32122065-32122087 ACCACCAACCACAGCAGCAAGGG - Intergenic
1182754600 22:32668585-32668607 GCTTCCAACAACAACAACAAAGG - Intronic
949421997 3:3875593-3875615 GCCCCCATCCACAGCTCCAATGG + Intronic
950040505 3:9916634-9916656 GCCCACAGCAACAGCACAGATGG + Intergenic
950535272 3:13574780-13574802 TCCCCCAACAACAGCAGCCAGGG + Intronic
952366837 3:32682493-32682515 GCCCTCAACAACCACACAAATGG + Intergenic
954004142 3:47578629-47578651 GCCCCCAGAAACAGCAGCAGTGG + Exonic
954948677 3:54449627-54449649 TATCTCAACAACAGCACCAAGGG - Intronic
957881053 3:86213369-86213391 GGACCCAACAATAGCTCCAATGG - Intergenic
958736737 3:98018218-98018240 TCCACCAACCACAGCACAAATGG - Intronic
963010947 3:140769809-140769831 GCCCCCATCAACAGCATAAGTGG + Intergenic
965213606 3:165829765-165829787 ATCCCCAACAACATCACCCAAGG + Exonic
965482913 3:169242522-169242544 GCCCGCATCAGGAGCACCAAGGG - Intronic
970452627 4:16185986-16186008 GCCCCCAAGAACAGTCCCAGGGG - Intronic
972573989 4:40335201-40335223 GCCCCCCACAACAGCACTGTTGG + Intergenic
973716047 4:53677269-53677291 GATCACAAGAACAGCACCAAAGG - Intronic
973801422 4:54482501-54482523 ACCAGCAACAACAACACCAATGG + Intergenic
976631356 4:87240122-87240144 GCCCCTAAAAGCAGCACCCAGGG + Intronic
980841607 4:138268155-138268177 TCCCTCAAGAACAGCACAAAAGG - Intergenic
985007641 4:185550011-185550033 TATCACAACAACAGCACCAAAGG + Intergenic
985530581 5:431595-431617 GCCCCCAACAGCAGCCCCCATGG + Intronic
986781766 5:11072928-11072950 GCCCCCAAGGGCAGCACCACTGG + Intronic
992166153 5:74053996-74054018 GCACCCAGCAAGAGCAGCAAAGG - Intergenic
992195017 5:74330548-74330570 GTGCCCACCAACAGCCCCAAGGG + Intergenic
994657132 5:102607788-102607810 GCCAGCAACATCAGCACCACTGG - Intergenic
997303608 5:132823630-132823652 GCACCAAACAACAGCATCCAGGG - Exonic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
1001931670 5:175677636-175677658 GGCCCCAGCATCAGCACCCAAGG - Intronic
1003372379 6:5540972-5540994 ACCCCTAACAACAGCACCAAAGG - Intronic
1012456367 6:99410890-99410912 GCCACCAACACCAGGCCCAATGG - Exonic
1016683094 6:146853018-146853040 CACCACAAGAACAGCACCAAGGG + Intergenic
1017613223 6:156213720-156213742 GCCCACAACAACAGCAACTTTGG + Intergenic
1018905733 6:168074334-168074356 GCCCCCCAGAACAGCACAATCGG + Intronic
1023384690 7:39644268-39644290 GCTCCCAAAATAAGCACCAATGG - Intronic
1024282700 7:47732622-47732644 TCCCCCAAGAATGGCACCAAGGG - Intronic
1028980449 7:96962371-96962393 GCCTCTAAAAACAGGACCAAAGG + Intergenic
1029846321 7:103415570-103415592 GCCCCCAACAACAGAGTAAATGG + Intronic
1030019847 7:105262648-105262670 GCCTCCAACAACAACACCCTAGG + Intronic
1035983448 8:4399254-4399276 CCCCACAAAAACAGCAACAAAGG + Intronic
1036750778 8:11442694-11442716 CCCCCCACCAAGAGCACCAGGGG + Intronic
1041907869 8:63053532-63053554 TATCACAACAACAGCACCAAGGG + Intronic
1043075830 8:75698320-75698342 CCCGCCATGAACAGCACCAATGG - Intergenic
1043150295 8:76706321-76706343 GCCCCCAACACCAGCCTCAGTGG + Exonic
1049767112 8:144360015-144360037 GCCCCCATCAACGGCACCCCTGG + Exonic
1053046759 9:34926615-34926637 GGCCCCAAAAACAGCCCCACAGG - Intergenic
1053413146 9:37928681-37928703 GCCCCTCACCACAGCAGCAAGGG - Intronic
1056445200 9:86658977-86658999 GCCCCTAACTACAGCCCCACAGG - Intergenic
1062033685 9:134373239-134373261 TAGCCCAAGAACAGCACCAAAGG - Intronic
1062518655 9:136948204-136948226 GCCACCAACCACAGCACCCAAGG - Intronic
1188002303 X:24994389-24994411 ACCTCCAACAACAGCAACACGGG - Intronic
1190125420 X:47700656-47700678 GCCCCAAACAACAGCAATAGTGG - Intergenic
1195154959 X:102113631-102113653 GCCCACCACAACAGCTCCCAGGG - Intergenic
1199978028 X:152905762-152905784 ACCACCAGCACCAGCACCAAGGG - Intergenic