ID: 901323737

View in Genome Browser
Species Human (GRCh38)
Location 1:8355226-8355248
Sequence TCAGCTACACAGGAGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4775
Summary {0: 1, 1: 0, 2: 142, 3: 1589, 4: 3043}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901323737_901323750 24 Left 901323737 1:8355226-8355248 CCCGCAGCCTCCTGTGTAGCTGA 0: 1
1: 0
2: 142
3: 1589
4: 3043
Right 901323750 1:8355273-8355295 CTCTGTTTCTCCCATCACCATGG 0: 1
1: 0
2: 1
3: 26
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901323737 Original CRISPR TCAGCTACACAGGAGGCTGC GGG (reversed) Intronic
Too many off-targets to display for this crispr