ID: 901324794

View in Genome Browser
Species Human (GRCh38)
Location 1:8359926-8359948
Sequence CATGAAGTACAGGTCTGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901324782_901324794 14 Left 901324782 1:8359889-8359911 CCTCCCTCTTCTTGGCCAGCTTG 0: 1
1: 0
2: 3
3: 24
4: 299
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105
901324785_901324794 10 Left 901324785 1:8359893-8359915 CCTCTTCTTGGCCAGCTTGGACC 0: 1
1: 1
2: 5
3: 25
4: 200
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105
901324784_901324794 11 Left 901324784 1:8359892-8359914 CCCTCTTCTTGGCCAGCTTGGAC 0: 1
1: 0
2: 3
3: 24
4: 277
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105
901324788_901324794 -1 Left 901324788 1:8359904-8359926 CCAGCTTGGACCCGGCCAGAGGC 0: 1
1: 0
2: 1
3: 16
4: 124
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105
901324781_901324794 17 Left 901324781 1:8359886-8359908 CCTCCTCCCTCTTCTTGGCCAGC 0: 1
1: 2
2: 3
3: 77
4: 625
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105
901324779_901324794 29 Left 901324779 1:8359874-8359896 CCTTCTCAATGGCCTCCTCCCTC 0: 1
1: 0
2: 9
3: 74
4: 648
Right 901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901324794 Original CRISPR CATGAAGTACAGGTCTGTCC GGG Exonic
901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG + Exonic
903486510 1:23693089-23693111 CATTAAGAACAGGGCTGTACGGG + Intronic
906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG + Intergenic
908010961 1:59777120-59777142 CATCAGGTCCAGTTCTGTCCAGG + Intergenic
916940694 1:169674128-169674150 CATGAAGAACAGGTCCTTTCTGG + Intronic
918629619 1:186701184-186701206 TATGAATTACAGGTTTGTCAGGG + Intergenic
921550255 1:216526756-216526778 CATGAAGCACAAGGCTGTCTGGG + Intronic
1063066638 10:2616469-2616491 CATGAAGAACAGGGCTGTCCAGG - Intergenic
1065564476 10:26995067-26995089 CATCTATTGCAGGTCTGTCCTGG + Intronic
1066757308 10:38723636-38723658 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1073913652 10:108377027-108377049 AATGAACTACAGGACTGTCAGGG - Intergenic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1078615029 11:12856790-12856812 CATGAAGGACTGGACTGCCCTGG - Intronic
1080588202 11:33700044-33700066 CATGAAGTTCAGATCTGTGGTGG + Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1084288201 11:68145530-68145552 CACGCAGAACAGGGCTGTCCTGG - Intergenic
1086383535 11:86284662-86284684 CATGAAGTACAGGGGGCTCCAGG - Intergenic
1094001411 12:25698753-25698775 CATAATGTACAGCTTTGTCCTGG + Intergenic
1097817578 12:64091460-64091482 CATTATGTCCAAGTCTGTCCTGG + Intronic
1099423840 12:82498901-82498923 CATGGAGTCCAGTTCTGTACTGG - Intergenic
1101448773 12:104757281-104757303 CATGAAGTTCCTGTTTGTCCGGG + Exonic
1110727877 13:78846934-78846956 CATGAAGTAGAAGGCTGCCCAGG - Intergenic
1124200175 15:27672489-27672511 GAGGAAGTACAGGGCTCTCCTGG + Intergenic
1127770750 15:62228595-62228617 CTTAAAGCACAGGACTGTCCTGG + Intergenic
1128126710 15:65198351-65198373 GATGAAGTTCAGGTCAGTCTGGG + Exonic
1129204219 15:74025873-74025895 CATGAAGGACTGGCCAGTCCTGG - Intronic
1130902081 15:88214851-88214873 CCTGAAGTGCAGGGCTGTCGGGG + Intronic
1131560537 15:93435906-93435928 GATAAAATACAGGTCTGTCATGG - Intergenic
1132635924 16:946546-946568 CAGGAAGACCAGGACTGTCCGGG - Intronic
1136720214 16:32314089-32314111 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1136725266 16:32352482-32352504 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1136838590 16:33520365-33520387 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1140811178 16:78579597-78579619 CTTGAAGTACAGGAGTTTCCTGG - Intronic
1141004056 16:80335880-80335902 CCTGGGGTACAGGTCTGCCCAGG - Intergenic
1141250393 16:82351191-82351213 CATGAAGTACAGGTATACCTTGG + Intergenic
1142428513 16:90013445-90013467 CATGCAGCACAGGGCTGGCCAGG + Intronic
1203001164 16_KI270728v1_random:165272-165294 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1203006217 16_KI270728v1_random:203680-203702 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1203132767 16_KI270728v1_random:1701676-1701698 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1145766385 17:27460834-27460856 CAGTAACTAAAGGTCTGTCCAGG - Intronic
1145775911 17:27528525-27528547 GAAGAAGTACAGGTCTCTCCTGG - Intronic
1147320878 17:39645219-39645241 CAGGAAGTAGAGGACTGTCCTGG - Intronic
1150464081 17:65377069-65377091 CATGAAGCAAAGCTGTGTCCAGG + Intergenic
1156117474 18:33803211-33803233 CAGTTAGTACAGGTCTGTCTTGG - Intergenic
1156405067 18:36775726-36775748 CATGCAGCACAGGACTGTCTGGG - Intronic
1160979507 19:1810557-1810579 TATGAAGTTCAGGGCTGGCCAGG - Intronic
925035378 2:680846-680868 CATGCAGTTCAGATCTGTCGGGG + Intergenic
928860894 2:35856025-35856047 CATGAAATAAGGGTCTGTGCTGG + Intergenic
929301446 2:40308333-40308355 AATGAAGTACAGTTTTGCCCAGG - Intronic
932397965 2:71461098-71461120 CGTGTAGTACAGGACTGGCCTGG - Intronic
933824223 2:86143893-86143915 CAAAAAGTACAGTTCTGGCCAGG - Intergenic
936491165 2:112973318-112973340 CATGCTGTACAGGTTTGTACAGG + Intronic
944253528 2:197601057-197601079 CATGAAGGACAGGTCAGCCAGGG + Intronic
945556640 2:211284360-211284382 CATGCATTACAGGTCTTACCTGG - Intergenic
947469097 2:230383663-230383685 CAGGAAGTACAGAACTCTCCTGG - Intronic
947548967 2:231032966-231032988 CAGCCAGTACAGGTGTGTCCTGG + Intergenic
948194766 2:236087178-236087200 CAGGAAGTGAAAGTCTGTCCAGG + Intronic
948730563 2:239961263-239961285 CATGAAGTACAGGCATCTGCCGG - Intronic
1174065981 20:47866524-47866546 CATCAAGTAAAGGTCTGGGCTGG - Intergenic
1180308862 22:11152136-11152158 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1180547339 22:16513947-16513969 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1182211826 22:28683387-28683409 CATGAAAGCCAGGTCTGACCAGG - Intergenic
1185147487 22:49147199-49147221 CCTGGAGGACAGGTCTGTCCTGG - Intergenic
953103153 3:39849981-39850003 CAGGAAGTACAGGCATGTCGTGG - Intronic
953439461 3:42905812-42905834 CATAAAATACAGGTCTGCTCTGG + Intronic
964366596 3:155957140-155957162 CATGAAGTAGAGTTCTGTACAGG + Intergenic
965794374 3:172424102-172424124 CATGAAGTCCAGGTTTATGCTGG - Intergenic
967318266 3:188170827-188170849 AATGAAGTAGATGTCTTTCCAGG - Intronic
968997410 4:3954702-3954724 CATGAATTACAAATGTGTCCGGG + Intergenic
969844715 4:9911284-9911306 TGTGATGTACAGGTCTGCCCCGG - Intronic
981044303 4:140252140-140252162 CATAAATCACAGGTCTATCCAGG + Intergenic
982368355 4:154605618-154605640 CATGAACTACAGCTCTGGCATGG + Intronic
984358515 4:178696720-178696742 CATGTTGTCCAGCTCTGTCCTGG - Intergenic
985204217 4:187516827-187516849 CATGAAGTACAGGTGTTTCATGG + Intergenic
985283615 4:188311916-188311938 CATTAAGAGCAGGACTGTCCTGG + Intergenic
986305466 5:6511057-6511079 AACCAAGGACAGGTCTGTCCTGG - Intergenic
986335618 5:6753032-6753054 CATAAGGTATAGCTCTGTCCTGG + Exonic
987242919 5:16019308-16019330 CATGATGGACAGTTCTCTCCTGG + Intergenic
990558611 5:56961634-56961656 CATGGATGACAGCTCTGTCCAGG + Intronic
993935047 5:93988799-93988821 CATAAAGTAAAGGTCCTTCCAGG + Intronic
995945076 5:117635298-117635320 CATTAAGGAAAGGGCTGTCCTGG - Intergenic
996260009 5:121455599-121455621 TATGAAGAACAGGTCAGGCCAGG - Intergenic
998789474 5:145750584-145750606 CATGAAATTCAGATCTGACCAGG + Intronic
998930925 5:147181034-147181056 CTTAAAGTACAGGGCTGTCTGGG - Intergenic
999724087 5:154420555-154420577 CAAGAAGTGCAGTTCTGTTCTGG + Exonic
1006122537 6:31816014-31816036 CATGAAGCACTGGCCTTTCCAGG + Exonic
1006124400 6:31828208-31828230 CATGAAGCACTGGCCTTTCCAGG + Exonic
1011399064 6:86940046-86940068 CCTGAACTAGAGGTGTGTCCTGG - Intronic
1019373912 7:678644-678666 CAGGAAGTCCCTGTCTGTCCAGG + Intronic
1020004856 7:4777158-4777180 CATGAATGACATATCTGTCCAGG - Intronic
1024510395 7:50199531-50199553 CAGGAAGCGCAGGCCTGTCCTGG + Intergenic
1032998705 7:137478758-137478780 CATGAAGCTAAGGTCTGTCCTGG - Intronic
1035990800 8:4488273-4488295 TATGAAGTAGAGGTCTTTCAGGG - Intronic
1038134884 8:24774632-24774654 CATAAAGTACAAGTTTTTCCTGG + Intergenic
1040794675 8:51275741-51275763 AATGCAGCACAGGTGTGTCCTGG + Intergenic
1042546434 8:69955486-69955508 CATGGAGTACAGGTGTGTGGTGG - Intergenic
1044044558 8:87414913-87414935 AATGACTTACAGGTCTGACCTGG + Intronic
1045456520 8:102385297-102385319 CATGAACTTCAGTTATGTCCAGG - Intronic
1048023377 8:130561504-130561526 CATGGAGTCCAGTGCTGTCCTGG - Intergenic
1053388251 9:37712649-37712671 TAAGAAGTACAGTTCTGGCCTGG - Intronic
1055697641 9:78904051-78904073 CCGGAAGTACAGGTCTACCCAGG + Intergenic
1057753365 9:97810001-97810023 CTTGAAGTCCAACTCTGTCCTGG - Intergenic
1060314730 9:122499133-122499155 CATGAAGGACAGGGCTGGACTGG + Intergenic
1061838292 9:133343245-133343267 CAGGAAGGAAAGGTTTGTCCAGG + Intronic
1188051273 X:25489816-25489838 CATGAACTTCTGGTCTCTCCAGG - Intergenic
1189971159 X:46419684-46419706 CAAGAGGTACAGGTCTGGCATGG + Intergenic
1190511316 X:51176621-51176643 CTTGAAGTTCAGTTCTGTGCAGG + Intergenic
1192319784 X:70080934-70080956 CATTTAGTACAAGTCTGTCTGGG - Intergenic
1195156068 X:102125774-102125796 CAGGAGGCACAGGCCTGTCCTGG + Exonic
1195158048 X:102142363-102142385 CAGGAGGCACAGGCCTGTCCTGG - Exonic
1198280110 X:135133435-135133457 CAAGAAGTAGAGGGCTGGCCCGG + Intergenic
1198290848 X:135239079-135239101 CAAGAAGTAGAGGGCTGGCCCGG - Intergenic
1201188112 Y:11423182-11423204 CATGAAAGCCAGGTCTGGCCAGG + Intergenic