ID: 901326767

View in Genome Browser
Species Human (GRCh38)
Location 1:8371342-8371364
Sequence CTATACACTAAGATGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901326760_901326767 20 Left 901326760 1:8371299-8371321 CCTGGACTTAGGAGTCTCTTCCC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 113
901326764_901326767 -1 Left 901326764 1:8371320-8371342 CCAGCAGAGGTGTCTTTCCAGGC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 113
901326762_901326767 0 Left 901326762 1:8371319-8371341 CCCAGCAGAGGTGTCTTTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 197
Right 901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901326767 Original CRISPR CTATACACTAAGATGGAGTT AGG Intronic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
904319238 1:29685748-29685770 GCAGACACTGAGATGGAGTTGGG - Intergenic
907544324 1:55246406-55246428 CACTACATTCAGATGGAGTTTGG + Intergenic
916589603 1:166177452-166177474 CCCTGCACTAAGGTGGAGTTAGG - Intergenic
919813876 1:201425790-201425812 CTAGACACTAAGCTGAATTTAGG + Intronic
922486074 1:225974156-225974178 CTATACAGAAATATGGATTTTGG - Intergenic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
1065056558 10:21849757-21849779 TTATACACTAAGATGAAGTGAGG + Intronic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1076174798 10:128360152-128360174 AGAGACACTGAGATGGAGTTAGG + Intergenic
1076221451 10:128736595-128736617 CTATAGACTAGGATGAACTTTGG - Intergenic
1078033134 11:7773804-7773826 CAATTCACAAAGATGGAGATTGG - Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1078863895 11:15278823-15278845 CTAAAGAATAAAATGGAGTTGGG + Intergenic
1079045292 11:17096480-17096502 CTATGCAATAAAATGGTGTTAGG + Intronic
1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG + Intronic
1083732656 11:64661121-64661143 CTATTCACTGAGATGGAGCCTGG + Exonic
1086280768 11:85185150-85185172 AGATACACCAAGATGCAGTTTGG + Intronic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1092804047 12:12202704-12202726 CTCTACACTAGGACGGGGTTTGG - Intronic
1095721519 12:45406322-45406344 CAAAACACTAAGGTGGAGCTGGG - Intronic
1098939360 12:76517173-76517195 CAATACATAAATATGGAGTTTGG - Intronic
1099754032 12:86817855-86817877 CTGTACACTAGGATAGAGTGTGG + Intronic
1100033002 12:90215786-90215808 TTATCCACTCAGATGGACTTTGG + Intergenic
1102092164 12:110200559-110200581 CTGTACACTATGATAGACTTTGG + Intronic
1102575873 12:113855828-113855850 CTATTCACTAATATGCAGTGTGG + Intronic
1105631258 13:22171111-22171133 CTTTACACAAAGAGGTAGTTCGG + Intergenic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1110387569 13:74931808-74931830 CTTTACCCTAAGTTGGAGCTAGG - Intergenic
1110668815 13:78151585-78151607 CTTGATACTAAGATGAAGTTGGG - Intergenic
1116914947 14:50515659-50515681 CTATACAAGAAGTTGTAGTTTGG - Intronic
1118079638 14:62343596-62343618 CTCTAAACTAAGACAGAGTTTGG - Intergenic
1123117408 14:105900918-105900940 CTGTACACCAAGGAGGAGTTAGG - Intergenic
1123759484 15:23421447-23421469 CTACACACTTAGAGTGAGTTTGG + Intergenic
1127817342 15:62622824-62622846 TAATAAAATAAGATGGAGTTTGG + Intronic
1127875999 15:63111806-63111828 CTTGACACTAGGATGCAGTTAGG - Intergenic
1132160926 15:99541655-99541677 CTGTACACAAAAATAGAGTTGGG - Intergenic
1134285059 16:12854064-12854086 CAATAAACTAAGATGGAATGTGG - Intergenic
1134456864 16:14401439-14401461 CTACACACTTAGAGTGAGTTTGG - Intergenic
1146607833 17:34276908-34276930 GTTTACACTAACATCGAGTTTGG + Intergenic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1155815022 18:30296622-30296644 CTATTTACTAAAATGGTGTTGGG - Intergenic
1157533996 18:48445071-48445093 GTACACACTGGGATGGAGTTTGG - Intergenic
1159010671 18:63056592-63056614 CTATATACTAAGAAGGATTGGGG - Intergenic
1159808127 18:72980665-72980687 ATTTACACTAAGTTGTAGTTAGG - Intergenic
1166031920 19:40137711-40137733 GCAGACACTAAGATGCAGTTTGG - Intergenic
927623058 2:24682482-24682504 CTATGCACTGAGATGGAGCCAGG - Intronic
933253038 2:80050038-80050060 CAACACACTAAGATAGAGTAGGG + Intronic
934728630 2:96641897-96641919 CTGTGCATTAAGATGGAGCTGGG - Intronic
937716171 2:125036143-125036165 CTATACACTAGAAGGGATTTGGG - Intergenic
939678221 2:145098300-145098322 CTATCCACTATTATTGAGTTAGG - Intergenic
940537712 2:154967633-154967655 CTATACACTATTTTGGTGTTGGG - Intergenic
943465678 2:188226415-188226437 CTATACACTTTGGTGGTGTTAGG + Intergenic
945402229 2:209397902-209397924 AGATGCTCTAAGATGGAGTTAGG + Intergenic
1170933779 20:20792463-20792485 GCAGACACCAAGATGGAGTTAGG - Intergenic
1173527285 20:43742920-43742942 CTCTACACTAAGATCTAGTCAGG + Intergenic
1174898389 20:54474766-54474788 CTATACAATAAGATGAAGAAGGG - Intergenic
1177087111 21:16719305-16719327 ATATACACAAAAATGGAGTTTGG + Intergenic
1177411422 21:20734859-20734881 CTATACCCCGAGATGGAGTGGGG + Intergenic
1184323071 22:43757807-43757829 GCAGACACTGAGATGGAGTTTGG - Intronic
956297232 3:67727986-67728008 CTAGACTCTAAGATGGTGTTAGG - Intergenic
956545299 3:70394552-70394574 ATATACACTGAGCTGCAGTTTGG + Intergenic
958089614 3:88859363-88859385 GTATAGACTAAGATGGTGATGGG - Intergenic
959938266 3:112053270-112053292 CCAGACACTAAGATGGATTGAGG - Intronic
962156560 3:132954532-132954554 CTATACATGAAGATAGACTTTGG + Intergenic
963931503 3:151008620-151008642 TTATATGCTAAGATGGAGTGAGG - Intergenic
964418416 3:156474244-156474266 ATTTACATTAAGATGGGGTTGGG + Intronic
979906733 4:126302683-126302705 CTCTACAAGAAAATGGAGTTTGG - Intergenic
979987964 4:127338757-127338779 GTATACTCTAAAATGGAGTTAGG - Intergenic
983336529 4:166400571-166400593 CTTAACACTATGAAGGAGTTAGG + Intergenic
984852180 4:184163888-184163910 CCATACACTAAGAAGGATCTTGG + Intronic
985625998 5:988143-988165 ATGTACACTGAGATGGACTTTGG + Intergenic
986578359 5:9236150-9236172 CTATAATTCAAGATGGAGTTTGG + Intronic
987500753 5:18706821-18706843 CTAAACACAAAGACTGAGTTTGG + Intergenic
987723356 5:21665612-21665634 TACTACACTAACATGGAGTTGGG + Intergenic
988673931 5:33411551-33411573 CTATACTCAAAGCTGAAGTTTGG + Intergenic
990761185 5:59131313-59131335 CTAGGCACTGGGATGGAGTTGGG - Intronic
994796069 5:104301352-104301374 CTTTACACTAAGCTGTAGTTAGG - Intergenic
995780061 5:115765418-115765440 TTATACACTAAGAAGGCTTTAGG + Intergenic
995823351 5:116264140-116264162 CTATACAGCAAGAGGTAGTTGGG - Intronic
995897092 5:117027248-117027270 CAAAACACTAATTTGGAGTTTGG + Intergenic
997705483 5:135947916-135947938 TTATACAATAAAATGGTGTTGGG + Intronic
1001185286 5:169565637-169565659 ATATACATTGAGATGGAGTTTGG + Intergenic
1003533874 6:6959170-6959192 AAAGACACTGAGATGGAGTTTGG + Intergenic
1004677240 6:17855157-17855179 CTATTCACAAAAATTGAGTTAGG - Intronic
1006693079 6:35907403-35907425 CTTTAAAATAAGATGGAGTGAGG + Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1008492814 6:52103626-52103648 TTTTACACTAAGTTGGAGGTGGG + Intergenic
1013030431 6:106327214-106327236 CTAAAAAATAAGATGGATTTAGG + Intergenic
1014955783 6:127614335-127614357 TTATATACTGAGATGGAGTTCGG + Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1020647670 7:10834768-10834790 CTATACACTAAGATAGGTTCTGG - Intergenic
1032227181 7:130041825-130041847 ATATACATTAAGAATGAGTTGGG - Intronic
1034220374 7:149440324-149440346 CTTTATAGTAAGATGGAGATGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037677912 8:21067754-21067776 CTTAACAATCAGATGGAGTTTGG + Intergenic
1038782142 8:30577252-30577274 CCATAAAATAAGATGGAGTGTGG + Intergenic
1039550022 8:38436657-38436679 CTATCCCCTAAGAAGGAATTAGG + Intronic
1041521200 8:58757947-58757969 CAAAACACTGAGATGGAGTTTGG - Intergenic
1043222072 8:77679079-77679101 CTATACAGTATGGTGGATTTGGG - Intergenic
1044188377 8:89283456-89283478 GTATTCACAAAGATGTAGTTTGG + Intergenic
1045883544 8:107069310-107069332 GCAGACACTGAGATGGAGTTTGG + Intergenic
1045890271 8:107147628-107147650 TTATACAATAAGTTGGATTTTGG + Intergenic
1046788952 8:118299724-118299746 AAATATACTAAGATGGATTTAGG + Intronic
1047268152 8:123328105-123328127 CAATAAACTAAGATGCAATTAGG + Intronic
1047549931 8:125859979-125860001 GTAGACACTGAGATGGAGTTGGG + Intergenic
1048413039 8:134195606-134195628 CTTTACACTCAGACAGAGTTGGG - Intergenic
1050044217 9:1526676-1526698 GCAGACACTGAGATGGAGTTTGG + Intergenic
1051504788 9:17815080-17815102 TTTTTCACTAAGATGAAGTTTGG + Intergenic
1051599999 9:18863098-18863120 CTGTACTGTAAGATAGAGTTTGG - Intronic
1053128617 9:35602770-35602792 ATATACACAAATATGGAGTGGGG + Intergenic
1055901802 9:81247992-81248014 GTATACACTTCGATGGCGTTAGG - Intergenic
1058367589 9:104228366-104228388 ATATTAACTATGATGGAGTTTGG - Intergenic
1058396817 9:104563439-104563461 CTATACTATAAAATGAAGTTCGG + Intergenic
1058486748 9:105448756-105448778 CTAAACACTAAGATCTACTTAGG - Intronic
1059549228 9:115211769-115211791 CTATTCACTAAAATGCACTTGGG + Intronic
1060014599 9:120075969-120075991 ATATACAATAAGTTGGATTTTGG - Intergenic
1062731615 9:138113257-138113279 GTATCCCATAAGATGGAGTTGGG - Intronic
1062731641 9:138113389-138113411 GTATCCCATAAGATGGAGTTGGG - Intronic
1185949525 X:4416056-4416078 CTATAAACTACTATGGACTTTGG - Intergenic
1186681697 X:11881753-11881775 CTGTACAATAAAATGGACTTTGG - Intergenic
1187096238 X:16151434-16151456 CTATTCACTGAAATGGAGTGGGG - Intronic
1187219618 X:17310856-17310878 TTATTCACTCAGATGGATTTTGG + Intergenic
1195263780 X:103160580-103160602 CTATGCACTCCAATGGAGTTGGG + Intergenic
1197456621 X:126683945-126683967 CTAGATTCTGAGATGGAGTTAGG - Intergenic