ID: 901328070

View in Genome Browser
Species Human (GRCh38)
Location 1:8381042-8381064
Sequence GGGGTGGGCCAGCAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901328070 Original CRISPR GGGGTGGGCCAGCAGCAACC AGG (reversed) Intronic
900010840 1:106414-106436 AGGGTGGCCCTCCAGCAACCAGG - Intergenic
900026942 1:282978-283000 AGGGTGGCCCTCCAGCAACCAGG - Intergenic
900029435 1:360127-360149 GGGGTGAGCCACCAGCCACATGG + Intergenic
900050037 1:588899-588921 GGGGTGAGCCACCAGCCACATGG + Intergenic
900177292 1:1296462-1296484 CCGCTGGGCCAGCATCAACCTGG - Exonic
900366448 1:2313740-2313762 GTGGAGGGCAAGCAGGAACCAGG + Intergenic
900646742 1:3712504-3712526 GGGGTGGGGCAGCAGGACCCAGG - Intronic
900709256 1:4102345-4102367 GGGCAGGGCCAGCAGCTACGGGG + Intergenic
901328070 1:8381042-8381064 GGGGTGGGCCAGCAGCAACCAGG - Intronic
901471089 1:9456904-9456926 TGGGTGGGCCAGCAACCTCCAGG - Intergenic
901535836 1:9882639-9882661 GGGGTGGAGCAGCAGGAAGCAGG + Intronic
902291510 1:15438514-15438536 GGGGTGGGGCTGCAGCTAGCAGG + Intronic
902513506 1:16978456-16978478 TGGGTGGGCCAGCAGGGACTGGG - Intronic
902835585 1:19044769-19044791 TGGGTGGGCCAGGAGCCAGCAGG + Intergenic
902891511 1:19447694-19447716 AGGGTGGCACAGCAGCACCCTGG + Intronic
902939679 1:19791733-19791755 GGGCTGGTCCAGCAGCGCCCTGG + Intronic
903266995 1:22163570-22163592 GGGGTGGGCCAGGAGCAGTGGGG + Intergenic
903676096 1:25065600-25065622 GGGGTCGGCCTGCAGCAGCCAGG - Intergenic
904932280 1:34098568-34098590 GGGGTGGTCCAGGAGTAAACAGG + Intronic
905104771 1:35557769-35557791 GGGGTGGAGCTGCAGCAGCCTGG + Intronic
905690091 1:39936657-39936679 AGGGTGGGTAGGCAGCAACCAGG - Intergenic
907919162 1:58896809-58896831 AGGGAGGGCCAGCAGGAGCCTGG + Intergenic
909314479 1:74198196-74198218 GGGGCGGGTCAGAAACAACCGGG + Exonic
912506608 1:110161070-110161092 GTCCTGGGCCAGCAGCATCCAGG + Intronic
914241918 1:145858404-145858426 GGGGTGGGGCAGAAGCATCCTGG - Intronic
916519287 1:165549209-165549231 GGGCTGGACCAGCAGCAGCAGGG + Intronic
918007572 1:180556359-180556381 GGGGGGACCCAGCAGCCACCTGG + Intergenic
918354998 1:183699667-183699689 GGGGCAGGCCAGCAGCAGCGAGG - Intronic
922947533 1:229529827-229529849 GGGGTGCTCCAGCAGCACCCTGG - Intronic
924340468 1:243025167-243025189 AGGGTGGCCCTCCAGCAACCAGG - Intergenic
924444717 1:244118530-244118552 GCGGTGGCCCAGCAGGACCCAGG + Intergenic
1062816710 10:506351-506373 GGGTTGGGACAGCAGCAGCAAGG + Intronic
1063536003 10:6884058-6884080 GGAGTTGGCCAGCAGGAAGCAGG - Intergenic
1066736031 10:38480432-38480454 AGGGTGGCCCTCCAGCAACCAGG + Intergenic
1067478185 10:46579544-46579566 TGTGAGGGCCAGCAGCAACGGGG + Intronic
1067847320 10:49734867-49734889 GGGTGGGGCGAGCAGCAGCCAGG + Exonic
1068917238 10:62445494-62445516 GGGGTGAGGCAGCCCCAACCAGG + Intronic
1070933069 10:80274308-80274330 TGACTGGGCCAGCAGGAACCTGG + Intronic
1071484225 10:86087767-86087789 GAGGTGGGCCAGCAGCCATGTGG - Intronic
1071511408 10:86264703-86264725 GGGCTGGGCCTGCAGCTGCCTGG - Intronic
1072187965 10:93060454-93060476 GGGGTGGGCCAGGAGCACTGCGG + Intergenic
1072524096 10:96256146-96256168 GGGCTGAGCCAGCAGCCCCCAGG - Intronic
1075022082 10:118959502-118959524 GGGATGGACCCCCAGCAACCCGG + Intergenic
1075631225 10:124001707-124001729 GGTGTGGGCGAGCAGCGCCCGGG + Intergenic
1075644817 10:124090657-124090679 GGCCAGGGGCAGCAGCAACCAGG + Intronic
1076835058 10:133016846-133016868 GTGGTGGGGCAGCAGCTTCCTGG - Intergenic
1077037498 11:502499-502521 AGGGCGGGACAGCAGCAGCCCGG + Exonic
1077393150 11:2309000-2309022 GGTGAGGGCCAGCAGCTCCCTGG + Intronic
1078760983 11:14251685-14251707 GGGGTGGTCCAGCAGTCCCCTGG - Intronic
1078801124 11:14644527-14644549 GGGCAGCGCCAGCAGCCACCAGG - Exonic
1079374427 11:19879435-19879457 GGAGTGGGACAGCAGCCACTTGG + Intronic
1081703914 11:45169094-45169116 GGGGTGGGGGAGAGGCAACCTGG + Intronic
1083941960 11:65900601-65900623 GGGGCGGGCCCGCAGCCTCCGGG - Intergenic
1084151783 11:67290932-67290954 GTGGAGGGCCAGCCTCAACCTGG - Intronic
1084392895 11:68890331-68890353 GAGCTGGGCCAGCACCTACCAGG + Intergenic
1084416730 11:69036772-69036794 GGGGTGGGAGGGCAGAAACCTGG + Intergenic
1084588618 11:70077908-70077930 GGGGCGGGTCGGCAGGAACCAGG + Intergenic
1084641941 11:70431420-70431442 GGGGTGGGCCAGGAGCGCCTGGG + Intronic
1084674065 11:70624113-70624135 GGGGTGGGCCCGGAGCTTCCTGG + Intronic
1089037224 11:115407420-115407442 TGTGTGGGCCAGCAGCATCTTGG + Intronic
1089743159 11:120598979-120599001 GGGGTGTGCCTGCAGGAACGAGG + Intronic
1090326127 11:125887805-125887827 GCAGTGGGCCGGCAGCCACCAGG - Intronic
1090462242 11:126901932-126901954 GGGGTGTGCCCGAAGCCACCTGG - Intronic
1091279756 11:134375119-134375141 GGGGTGGGGCAGCAGCCACCAGG - Exonic
1091309205 11:134560908-134560930 GGGGGGGGCCAGCAGGGCCCAGG + Intergenic
1092919435 12:13217895-13217917 GGGGTGGGCCAGCAGAGAGCTGG + Exonic
1093542011 12:20298709-20298731 AGGGTGGGGCAGCAGCAGCAAGG + Intergenic
1094783344 12:33818272-33818294 GGGGTGGGCCAGCAGGGATGGGG + Intergenic
1096902523 12:54900035-54900057 GGGGTGGGGGGGCAGCAACGAGG + Intergenic
1097078260 12:56410815-56410837 TGGGAGGGCCAGGAGCAAGCAGG - Intergenic
1098147854 12:67516068-67516090 GCTGTGGGCCTGCAACAACCAGG + Intergenic
1101511098 12:105393116-105393138 GGGGTAGGAGAACAGCAACCTGG - Intronic
1101881702 12:108630208-108630230 GGCCTGGGCCAGAAGCAGCCTGG - Intronic
1102492580 12:113297968-113297990 TGGAGGGGCCAGCAGCACCCCGG + Exonic
1103955984 12:124577143-124577165 GGGCTGGGGCAGCAGCTCCCTGG + Intergenic
1103956299 12:124578643-124578665 GGCGTGGGCCAGGAGAAACCCGG + Intergenic
1105265410 13:18810293-18810315 GGGTCGGGTGAGCAGCAACCTGG - Intergenic
1105412115 13:20179090-20179112 GTGGTGGGCCAGCAGCCAGGTGG - Intergenic
1105423333 13:20272386-20272408 GGGATGGTCCAGCAGAAAACAGG + Intergenic
1107069745 13:36256928-36256950 CAGGTGGGCCAGCAGCAGCTGGG + Intronic
1108139128 13:47399757-47399779 GGGCTGGGCCTGATGCAACCTGG - Intergenic
1108955375 13:56149452-56149474 GGGGTGGGCCAGCCACAGACTGG + Intergenic
1112278332 13:98040963-98040985 GGAATGAACCAGCAGCAACCTGG - Intergenic
1112502406 13:99953235-99953257 GCGGTGGCCCAGCAGCGGCCAGG + Intergenic
1113348188 13:109501605-109501627 GGGGTGGGCGAGCATAGACCGGG - Intergenic
1114417595 14:22554770-22554792 GGGGTGGACCAGGAGCAAGTGGG + Intergenic
1114853416 14:26408268-26408290 TGGGTGGCCCAGCAACAGCCAGG + Intergenic
1119034968 14:71221817-71221839 GGTGAGGGGCAGCAGCCACCAGG + Intergenic
1119700355 14:76750538-76750560 GGGGGGGGTCAGCACCAGCCAGG + Intergenic
1121492834 14:94372217-94372239 GTGGAGGGCCAGCAGCACCAAGG - Intergenic
1122787202 14:104169215-104169237 GTGGTGGGCAGGCAGCATCCAGG + Intronic
1122901169 14:104782890-104782912 GGGGGGTGCCAGCTGCAGCCAGG + Intronic
1123494765 15:20814570-20814592 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1123551260 15:21383663-21383685 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1127903834 15:63361342-63361364 CAGGTGGGGCAACAGCAACCCGG - Intronic
1129034622 15:72641810-72641832 GGGGTGGGCCAGGGGCCACAAGG - Intergenic
1129215260 15:74095406-74095428 GGGGTGGGCCAGGGGCCACAAGG + Intergenic
1129521636 15:76189989-76190011 AGGGTGGCCAGGCAGCAACCTGG - Intronic
1129521842 15:76191146-76191168 AGGGTGGCCAGGCAGCAACCTGG - Intronic
1129732405 15:77939751-77939773 GGGGTGGGCCAGGCACCACCAGG + Intergenic
1130093435 15:80839552-80839574 AGGGTGGGCCTTCAGCAACGGGG + Intronic
1131380957 15:91963412-91963434 GGGGGGGGGCGGCAGCAGCCTGG + Intronic
1202959601 15_KI270727v1_random:110906-110928 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1132869493 16:2109472-2109494 GCTGTGGGCCAGCAGCAAGGTGG - Exonic
1133267608 16:4594318-4594340 GCAGTGGGTCAGCAGCGACCTGG - Intronic
1133894064 16:9908795-9908817 GAGCTGGGCGAGCAGCAAACAGG + Intronic
1134717923 16:16366127-16366149 GCTGTGGGCCAGCAGCAAGGTGG + Intergenic
1134880907 16:17744995-17745017 TGGGTGGGCCCGCAGCAGCGGGG + Intergenic
1134956828 16:18386032-18386054 GCTGTGGGCCAGCAGCAAGGTGG - Intergenic
1136569204 16:31086730-31086752 GGGGTGGGCGAGCTGCAGCAGGG + Exonic
1138482971 16:57316384-57316406 GGTGTTGGCCAGCACCTACCTGG + Intergenic
1139420670 16:66847731-66847753 GGGGAGGGCCAGAAGCAGCCTGG + Intronic
1139486295 16:67258445-67258467 CAGGTGGGCCAGCAGCTTCCAGG + Exonic
1139591236 16:67934454-67934476 GGGGTGGGCAGGCAGCCAGCAGG - Intronic
1139638448 16:68273708-68273730 GGAATGGGCAAGCAGCAACATGG + Intronic
1141739363 16:85880565-85880587 GGGGTAGGAGAGCACCAACCTGG + Intergenic
1142237457 16:88928933-88928955 ACGGTGGGCCAGCAGCAAGGCGG + Intronic
1142363985 16:89640197-89640219 AGGGTGGGGCAGCAGCAGCGTGG - Intergenic
1142453506 16:90200502-90200524 AGGGTGGCCCTCCAGCAACCAGG + Intergenic
1142614232 17:1125535-1125557 GGGGAGAGCCAGCAGGCACCGGG + Intronic
1142715070 17:1742818-1742840 GGGCTGGGCCAGCTGGAGCCTGG + Exonic
1145165796 17:20612704-20612726 GAGGTGGGCCTGCCGGAACCGGG - Intergenic
1146629514 17:34459798-34459820 GGGGTGGGGCAGGAGGAACTAGG - Intergenic
1147247697 17:39132898-39132920 GGGTTTGGCCAACAGCAACCAGG - Intronic
1147381847 17:40060987-40061009 GGGGAGGGCCAGCGGTAATCTGG - Intronic
1147471513 17:40666459-40666481 GGGGTGGGTCAGAAATAACCTGG - Intergenic
1147628236 17:41913730-41913752 GGGGTGGTCCTGCAGCAAGCGGG + Exonic
1147957952 17:44147976-44147998 GGGGTGTAACAGCAGCAGCCTGG - Exonic
1148150675 17:45395072-45395094 GGTGAGGGCCAGAAGCAGCCAGG + Exonic
1150418335 17:65005833-65005855 GGTGTGAGCCACCAGCACCCAGG + Intergenic
1151153387 17:72107225-72107247 GGGGTCAGCCAGGAGCACCCTGG + Intergenic
1151160970 17:72165642-72165664 GGGGAGAGCAAGCAGCAGCCGGG - Intergenic
1151365140 17:73612201-73612223 GTGGTGGCCCAGCTGCACCCGGG + Intronic
1151494566 17:74451812-74451834 GGGGTGGGGGAGCAGGCACCTGG - Intergenic
1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG + Exonic
1151956521 17:77382886-77382908 GGGGTCTGAGAGCAGCAACCAGG - Intronic
1152772653 17:82179673-82179695 GGGGTGGGAACGCAGGAACCCGG + Intronic
1152950322 17:83226429-83226451 GGGGTGAGCCACCAGCCACATGG - Intergenic
1153674323 18:7442797-7442819 GGGGTGAGCCAGCATCAGCCAGG + Intergenic
1154206882 18:12345110-12345132 AGGGTGCGCCAGCATCAGCCTGG - Intronic
1154353252 18:13604881-13604903 GGGGCGTGCCAGCAGCCACCAGG + Intronic
1154452168 18:14487091-14487113 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1156694349 18:39748944-39748966 GGGGCAGGACAGCAGCAATCTGG - Intergenic
1157294539 18:46433277-46433299 GGGGTGGGCCAGCGGGAAGTCGG - Exonic
1157984487 18:52421513-52421535 GGGCTGGGGCAGCAGCAGCAAGG - Intronic
1161119337 19:2516852-2516874 GGGGCGGGCTGGCAGCAGCCCGG - Intronic
1161280482 19:3442930-3442952 GGGGTGGGGCAGCATCGCCCTGG - Intronic
1161477202 19:4493477-4493499 GGGAAGGGCCAGCAGCTGCCCGG + Intronic
1161849547 19:6731410-6731432 GGGGTGGGCGTGCAGCAGGCCGG + Intronic
1163019859 19:14476155-14476177 GGGATGTGGCGGCAGCAACCTGG - Intergenic
1163319804 19:16567971-16567993 GGGGTGTGCGGGCAGCAAACTGG - Intronic
1163428057 19:17249973-17249995 GGGTCAGGCCAGAAGCAACCTGG - Exonic
1163828579 19:19537177-19537199 GGGGTGGGGCAGCAGGACTCTGG + Intronic
1164732694 19:30518204-30518226 GCGAAGGGGCAGCAGCAACCTGG + Intronic
1164736273 19:30543732-30543754 GGGGTGGGGCAGCAACCACAAGG - Intronic
1166228216 19:41410570-41410592 GGGCTGAGCCAGCGGAAACCTGG + Intronic
1167129147 19:47573054-47573076 GGGCAGGGGCAGCAGCAACCGGG + Intergenic
1167369422 19:49071907-49071929 GGGGTGGGCCAGCCGAAGACAGG - Intronic
1168282228 19:55311933-55311955 GGGGTGGGGCACCAGCAGGCCGG - Exonic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
1202639589 1_KI270706v1_random:69901-69923 GGGTCGGGTGAGCAGCAACCTGG - Intergenic
925731192 2:6920287-6920309 CAGGTGGGCCAGCACCCACCTGG + Intronic
926156025 2:10454455-10454477 GGGAGGGGCCTGCAGCACCCAGG + Intergenic
926188437 2:10709399-10709421 GGGGTCTGGCAGCAGCAGCCTGG + Intergenic
927906697 2:26863480-26863502 GGGCTGGGCCTGCAGCACCCTGG + Intronic
937963301 2:127480490-127480512 GGGTTGGGCCAGCAGGACCCGGG - Intronic
938058839 2:128236592-128236614 GGGGCGGGGCAGCCGCAGCCAGG + Intergenic
941385121 2:164842086-164842108 GGGGTGGGCCGGGAGCAAGTTGG + Intronic
943656417 2:190513417-190513439 GGGGTAAGGCAGCAGTAACCAGG - Intronic
944584712 2:201163468-201163490 GTGGTGGCCCAGCAGGAAGCGGG + Intronic
945673903 2:212832870-212832892 CAGGTGGGCCAGCAGCAGCTGGG - Intergenic
946169208 2:217884514-217884536 GGGGTGTGGCAGCAGCAAGGGGG - Intronic
946321290 2:218955907-218955929 GGGGGGGGGCAGCAGGATCCAGG + Intergenic
947476060 2:230448719-230448741 GGGGTGGGCATGAGGCAACCAGG + Intronic
947489605 2:230582175-230582197 GGGGTGGGCATGAGGCAACCAGG - Intergenic
947605790 2:231484223-231484245 GGGGTGGGGCAAGAGCAATCAGG + Intergenic
947652207 2:231796398-231796420 GGGGTGGGCCTGTAGCTACCTGG + Intronic
947832835 2:233153879-233153901 GGGGCTGGCCAGCAGCATCCTGG - Intronic
948501937 2:238401678-238401700 AGTGTGAGCCAGCAGCAAGCAGG + Intergenic
948654553 2:239468727-239468749 GGGGTGGGCCACCAGGAGCATGG - Intergenic
948667580 2:239546045-239546067 GGGGTGGGACAGAAGCCACAGGG - Intergenic
949040994 2:241849978-241850000 GGGCAGGGCCACCAGCATCCAGG - Exonic
949084949 2:242145151-242145173 AGGGTGGCCCTCCAGCAACCAGG + Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169119022 20:3084372-3084394 GGGGTGGGCCAGAGGGGACCAGG - Intronic
1169207012 20:3746192-3746214 GGAGTGGGCCTGCAGGAACAGGG + Intronic
1170399122 20:15960756-15960778 TGGATGGGCCAGAAGTAACCAGG - Intronic
1171250208 20:23640640-23640662 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171256316 20:23691260-23691282 GGGATGGATCAGCAGGAACCTGG + Intergenic
1171263669 20:23753170-23753192 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171284251 20:23924366-23924388 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171886254 20:30654256-30654278 GGGTCGGGTGAGCAGCAACCTGG - Intergenic
1173617909 20:44414712-44414734 CAGGTGGGCCAGCAGCCCCCTGG - Intronic
1173826160 20:46048962-46048984 GGGTTGGGCATGCAGCACCCAGG - Intronic
1174109986 20:48192312-48192334 GGTGTGGGCCAGCTCCAACTGGG + Intergenic
1174385727 20:50187611-50187633 GGGGTGGGGGAGCAGCAGGCGGG + Intergenic
1174800449 20:53559033-53559055 GTGGTGGGCAAACAGCAAGCAGG - Intergenic
1175872292 20:62214232-62214254 GGTGTGGGCCAGCATCTGCCTGG + Intergenic
1175993939 20:62804220-62804242 GGGGTCCGCCAGCAGCTTCCAGG + Intergenic
1176443857 21:6801209-6801231 GGGGCGGGGAAGCAGCATCCTGG + Intergenic
1176850473 21:13908716-13908738 GGGTCGGGTGAGCAGCAACCTGG - Intergenic
1178521113 21:33289194-33289216 GAGGTGAGACAGCAGCAGCCAGG + Intronic
1179373244 21:40826370-40826392 GGGGTGGGCCAGCCCAAGCCAGG + Intronic
1180009928 21:45042882-45042904 GGGGAGGGCCGGCAGATACCTGG - Intergenic
1180050775 21:45330108-45330130 GGGCTGGGCTGCCAGCAACCCGG - Intergenic
1180177918 21:46098983-46099005 GGGCTGTGCCAGCAGAACCCCGG + Intronic
1180362353 22:11911969-11911991 GGGTCGGGTGAGCAGCAACCTGG + Intergenic
1181273429 22:21674009-21674031 TGGGTTGGCCAGCAGCAGGCAGG + Intronic
1182076567 22:27499263-27499285 GGGCTGGGCCAGCCTCACCCGGG + Intergenic
1183069588 22:35386917-35386939 GGCGTGGGCCACCAGCAGCTCGG - Exonic
1183261186 22:36796981-36797003 GGGGTGGGGCAGCAGGGGCCTGG + Intergenic
1183950797 22:41351625-41351647 GGGGAAGGCCAGCAGCAGCATGG + Exonic
1184113424 22:42408689-42408711 AGGGTGGGCCAGCATCGAACAGG + Intronic
1184470686 22:44694179-44694201 GGGCTGGGCCAGCACCACACAGG - Intronic
1184515094 22:44956884-44956906 GGGCTGGGCCTGCAGCATTCAGG + Intronic
1184798791 22:46747776-46747798 GGGCTAGGCCAGCTGCACCCTGG + Intergenic
1185050393 22:48551226-48551248 AGGCTGGGCCTGCAGCACCCTGG + Intronic
1185289431 22:50016181-50016203 GGCGAGGGCCAGCAGCATGCTGG + Intronic
950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG + Intronic
950425787 3:12924117-12924139 GGGGTGAGTCAGGAGCAAACAGG + Intronic
950427619 3:12932969-12932991 TGGGAGAGCCAGCAGCAAGCGGG - Intronic
950575362 3:13828990-13829012 GAGGTAGGCCAGCAGCAATGAGG - Intronic
951016367 3:17736672-17736694 GAGGTGTCCCAGCAGCTACCTGG - Intronic
951908702 3:27728392-27728414 GGGGGAGGCCAGGAGCAAACAGG + Intergenic
952593596 3:34988365-34988387 GAGAGGTGCCAGCAGCAACCGGG + Intergenic
954127232 3:48538762-48538784 GGGCTGGTCCAGCAGCTCCCTGG + Intronic
954361493 3:50125017-50125039 GGGGTGGGCACGCAGCAGCTCGG - Intergenic
954812683 3:53257683-53257705 GGGCTGGGCCAGCAGGAGCCAGG - Intergenic
956168638 3:66415301-66415323 GGGGTGGCCCAGCAGCTTCAAGG - Intronic
960054838 3:113269842-113269864 TGGGTGGCCCAGCAGCAGGCAGG + Intronic
961450958 3:127002110-127002132 CGGGCGGCCCAGGAGCAACCAGG - Intronic
961745085 3:129059528-129059550 GGGGACCCCCAGCAGCAACCAGG + Intergenic
961816327 3:129552522-129552544 GAGCTGGCCCAGCAGAAACCTGG + Intergenic
963036844 3:141037826-141037848 GGGGTGTAACAGCAGCAATCAGG + Intergenic
967535829 3:190601807-190601829 GAGGTGGGCCAGCTGCCAGCTGG + Intronic
967779413 3:193419382-193419404 GGGCAGGGGCAGCAGCAACTGGG - Intronic
967939888 3:194757433-194757455 GTGGTGGGCCAGCAGACCCCAGG + Intergenic
968013289 3:195302003-195302025 ACGGTGGGCCAGCATCAACCTGG - Exonic
968762729 4:2450859-2450881 GTGCTGGGCCAGCATCCACCTGG + Intronic
968816604 4:2824769-2824791 GGTGTGGGCCTGCAGGCACCAGG + Intronic
969608768 4:8215768-8215790 GGTATGGGCCAGCAGCAAGGTGG - Intronic
969696606 4:8738584-8738606 GGTGAGGGCCTGCAGCAGCCCGG + Intergenic
971990300 4:33884341-33884363 GTGCTCGACCAGCAGCAACCTGG - Intergenic
973369837 4:49236254-49236276 GGGTCGGGTCAGCAGCAACCTGG - Intergenic
973391195 4:49559158-49559180 GGGTCGGGTCAGCAGCAACCTGG + Intergenic
974543927 4:63275649-63275671 GGGGTGGGGCACCAGCAAGAAGG - Intergenic
975712732 4:77176643-77176665 GTGGTGGGCGAGCTGGAACCTGG - Intronic
979262383 4:118663394-118663416 AGGGTGGCCCTCCAGCAACCAGG + Intergenic
983149451 4:164259937-164259959 AGGGTGGCCCTCCAGCAACCAGG - Intronic
984885564 4:184446338-184446360 TGGCTGGGGCAGCAGCCACCTGG + Intronic
985712563 5:1437737-1437759 GGGAAGGGCCAGGAACAACCAGG + Intronic
988578288 5:32446831-32446853 GGGGTGTGCCAGTAGCACGCCGG - Intergenic
988934006 5:36064998-36065020 GGGGTGGGCCTGCTGGATCCTGG + Intronic
993047166 5:82880871-82880893 GGGTTGGTCCTGCAGCCACCAGG + Intergenic
998527664 5:142857393-142857415 AGGGTGGGCCAGCAGCTGCTAGG + Intronic
1000326442 5:160175927-160175949 GGGGAGAGCCCGCAGCTACCGGG + Intergenic
1002167734 5:177358661-177358683 GGGGTGGGGCAGCTGCAGCCAGG - Intronic
1002183802 5:177444630-177444652 GGGGTGGGGCAGCACCAAACAGG + Intergenic
1002439693 5:179257946-179257968 GGGGTCGGCCAGCAGCAGGAGGG - Intronic
1002618379 5:180469309-180469331 GGGGGTTCCCAGCAGCAACCTGG + Intergenic
1002744555 5:181460244-181460266 GGGGTGAGCCACCAGCCACATGG - Intergenic
1006909113 6:37552547-37552569 GGGGTTGGCCACCAGCCCCCAGG + Intergenic
1007427378 6:41756418-41756440 GGGTTTGGCCATCACCAACCGGG - Intergenic
1007447751 6:41920387-41920409 GGAGTGGGCCATAAGCAATCAGG - Intronic
1016916032 6:149245273-149245295 GAGGTGGGCTAAGAGCAACCTGG + Intronic
1019249465 6:170733785-170733807 GGGGTGAGCCACCAGCCACATGG - Intergenic
1019674909 7:2305119-2305141 GGGCTGAGCCAGCAGCACTCAGG + Intronic
1019706850 7:2500807-2500829 GGGGCAGGCCTGCAGCACCCAGG + Intergenic
1020092300 7:5348575-5348597 GAGGTGGCCCAGCAGAAATCCGG - Intronic
1021838496 7:24703733-24703755 GGGGTGGGGCAGCAGCCAGGGGG + Intronic
1021845363 7:24757649-24757671 GCGCTGGGCCGTCAGCAACCCGG - Intronic
1025262370 7:57427352-57427374 TGGATGGGCCAGCGGCAGCCGGG + Intergenic
1025739728 7:64184594-64184616 TGGGTGGGCCAGCGGCAGCCGGG + Intronic
1026001055 7:66558922-66558944 TGGGTTGGCCAGCGGCAGCCCGG + Intergenic
1026675934 7:72427992-72428014 GTGGTGGGGCAGGAGCACCCTGG - Intronic
1029105762 7:98174466-98174488 GGGATGGCACAGCAGCAAGCTGG - Intronic
1031899196 7:127391959-127391981 GGCGTGGGCCAGCAGCCGGCGGG - Intronic
1032011805 7:128352005-128352027 GGAGAGCGCCAGCAGCAGCCCGG + Exonic
1032159657 7:129500972-129500994 GGGGTGGGCCAGCCCCATCCAGG + Intergenic
1034470079 7:151250240-151250262 GGGGTGGTGGAGGAGCAACCTGG - Intronic
1035081195 7:156217672-156217694 AGGGTGGGACAGCAGGAGCCCGG - Intergenic
1035498631 8:73865-73887 GGGGTGAGCCACCAGCCACATGG + Intronic
1036374334 8:8187503-8187525 AGGGTGGGCCACCAGCAAAAAGG - Intergenic
1036876572 8:12478132-12478154 AGGGTGGGCCACCAGCAAAAAGG + Intergenic
1037800829 8:22034335-22034357 GGGGTGGGCCACCGGGAGCCTGG + Intronic
1038123295 8:24642419-24642441 GGGGTGGGAAAGCAGAAACCAGG - Intergenic
1041037891 8:53813920-53813942 GGGGTGAGCCTGGAGCTACCTGG - Intronic
1045538562 8:103059339-103059361 GGAGTGGTCCAGTAGGAACCAGG - Intronic
1049351139 8:142165448-142165470 GGGGTGGGTCAGCAGGGACTGGG - Intergenic
1049501961 8:142971697-142971719 AGGGTGGGGCAGCAGGAACCTGG + Intergenic
1049510333 8:143024085-143024107 AGGGCGGGGCAGCAGGAACCCGG - Intergenic
1049621176 8:143598961-143598983 CGGGTGGGCCACCAGCAGCACGG - Exonic
1049655391 8:143794828-143794850 TGGGTGGGGCAGCACCAACATGG + Intronic
1049711275 8:144064448-144064470 GGAGCTGGACAGCAGCAACCAGG + Intergenic
1052903656 9:33816727-33816749 GGGAGGGGCCTGCAGCGACCAGG + Intergenic
1057346843 9:94259172-94259194 GGGGCGGGACCGCAGCATCCAGG - Intergenic
1060863972 9:126980206-126980228 GGGGTGGTCCAGCCACAACATGG - Intronic
1061444905 9:130632226-130632248 GGGCTGGGGCAGCACCTACCAGG + Exonic
1061959328 9:133980055-133980077 AGGCTGGGCCACCAGCCACCCGG + Intronic
1062204657 9:135329359-135329381 GGGACGAGGCAGCAGCAACCAGG + Intergenic
1062236157 9:135508720-135508742 TGGGTGGGTCAGCAGCAGCATGG + Intergenic
1062289800 9:135789404-135789426 GGGGAGGGCGGGCAGCATCCTGG + Intronic
1062392080 9:136337887-136337909 GAGGAGGGCCTACAGCAACCTGG + Exonic
1062545731 9:137063075-137063097 TGGGTGGGCCAGTGGCAGCCAGG - Exonic
1062586192 9:137251065-137251087 GGGCTGGGCCAGGAGTCACCGGG + Intergenic
1062591804 9:137277788-137277810 GGGGTGGGCCAGGGGCCTCCTGG - Exonic
1203525343 Un_GL000213v1:83318-83340 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1203547697 Un_KI270743v1:140633-140655 GGGTCGGGTGAGCAGCAACCTGG - Intergenic
1203610364 Un_KI270748v1:90723-90745 GGGGTGAGCCACCAGCCACATGG - Intergenic
1185447735 X:268288-268310 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185447768 X:268398-268420 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185447801 X:268508-268530 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185447817 X:268563-268585 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185447833 X:268618-268640 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185447849 X:268673-268695 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185447928 X:268948-268970 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185447977 X:269113-269135 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185448092 X:269498-269520 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448207 X:269883-269905 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448273 X:270103-270125 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448304 X:270213-270235 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185448320 X:270268-270290 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448349 X:270378-270400 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448379 X:270488-270510 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185448395 X:270543-270565 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448411 X:270598-270620 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185448427 X:270653-270675 GGGCGGGGCCTGCAGCACCCGGG + Intergenic
1185448457 X:270763-270785 GGGTGGGGCCTGCAGCACCCGGG + Intergenic
1185449673 X:275624-275646 GGGGTGGACCGGAAGCAGCCAGG + Intergenic
1185596234 X:1308629-1308651 GGGGTGTGCAAGTGGCAACCAGG - Intronic
1193919442 X:87407208-87407230 GGGGAGGGCCAGGAGCAGGCAGG - Intergenic
1199543156 X:148979889-148979911 GGGCTGGGCTAGCAGCAAAGAGG + Intronic
1199886679 X:152027606-152027628 GGAGGGGGCCAGCAGCAAGAAGG - Intergenic
1199979822 X:152914849-152914871 GGGGAGGGACCGCAGCAACGTGG + Intronic
1202372762 Y:24209680-24209702 GGGGTGGGCAGGCAGGAACAGGG - Intergenic
1202384454 Y:24311883-24311905 AGGGTGGCCCTCCAGCAACCAGG + Intergenic
1202486329 Y:25358239-25358261 AGGGTGGCCCTCCAGCAACCAGG - Intergenic
1202498020 Y:25460440-25460462 GGGGTGGGCAGGCAGGAACAGGG + Intergenic