ID: 901328993

View in Genome Browser
Species Human (GRCh38)
Location 1:8390046-8390068
Sequence GGATGTTAACATAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901328993 Original CRISPR GGATGTTAACATAAGGAGGT GGG Intronic
901112677 1:6810813-6810835 AGCTGTTAACATCAAGAGGTGGG + Intronic
901328993 1:8390046-8390068 GGATGTTAACATAAGGAGGTGGG + Intronic
902881745 1:19376149-19376171 GCATGTTGAGATATGGAGGTGGG - Intronic
905344485 1:37302173-37302195 GGGTGTCACCATAAGGAGGCTGG - Intergenic
906078861 1:43070464-43070486 GCATTTTGACATATGGAGGTGGG + Intergenic
906375867 1:45296228-45296250 GGATTTCAACATAAGAATGTTGG - Intronic
908141209 1:61187274-61187296 GGATGCTAACATGAGAAGGGGGG - Intronic
908910012 1:69062336-69062358 GGCTGCTTATATAAGGAGGTGGG + Intergenic
909066563 1:70942056-70942078 GGATTGTAACATAAGGGGGTTGG - Intronic
909070603 1:70988951-70988973 GGGAGTTAACATGAGGAGGCTGG + Intronic
909196635 1:72634999-72635021 GGATGTTGGCATAGGGAGGCTGG - Intergenic
909426516 1:75531683-75531705 GGATGGTAAGATAAAGAGATTGG - Intronic
911254373 1:95617307-95617329 GGAAGATAACATAATGAGATGGG - Intergenic
918168197 1:181970540-181970562 GGATGCAAACCTGAGGAGGTGGG + Intergenic
924044065 1:240010269-240010291 GGATGTGTACACCAGGAGGTGGG - Intergenic
1063967569 10:11358898-11358920 AGATGATAGCATTAGGAGGTGGG + Intergenic
1066030406 10:31417229-31417251 GAATGTTACCATAAGGAGACTGG - Intronic
1067840772 10:49677290-49677312 GGATCCTAACTTAAGGAGGGTGG - Intergenic
1068323580 10:55453440-55453462 GGAGGTTACCATAAAGAGGTTGG - Intronic
1068383644 10:56294276-56294298 GGATGTTAACAGAAAGAATTAGG - Intergenic
1070471387 10:76783629-76783651 GGATGTGAACACCAGGAGGTAGG - Intergenic
1072188751 10:93064265-93064287 AGCTGTTAACACAAGGATGTTGG + Intronic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1076762937 10:132614688-132614710 GGATGTTAACACAGGAATGTGGG - Intronic
1077201864 11:1311767-1311789 GGATGTGAACACCAGGAGGCAGG - Intergenic
1079294714 11:19222595-19222617 GGGTGTAAACACCAGGAGGTGGG + Intergenic
1080777252 11:35397602-35397624 GGATTTCAACATAAGAAGTTTGG - Intronic
1081031240 11:38086345-38086367 GGATTTTATCATGAGGAGGATGG + Intergenic
1092547573 12:9465498-9465520 GGATGAGAGCATAAGAAGGTGGG - Intergenic
1093777817 12:23097893-23097915 GGATTCTAACCTGAGGAGGTGGG - Intergenic
1095222957 12:39640110-39640132 GGATGTTAACATATGAACTTGGG - Intronic
1099744088 12:86679572-86679594 AGATGATAATATTAGGAGGTGGG + Intronic
1100589606 12:96013998-96014020 GAATGTTCAAAAAAGGAGGTGGG + Intronic
1100745921 12:97645670-97645692 GGATGTGAAAACCAGGAGGTAGG - Intergenic
1101164118 12:102010375-102010397 ATATGTTAACATGAGGAGCTAGG + Intronic
1101648673 12:106654980-106655002 GGAAGCTAACAAAAGGAGGAAGG - Intronic
1102963954 12:117112078-117112100 GGATGTGAACAAAAGGCGGGAGG + Intergenic
1105428730 13:20317937-20317959 GGGTGATAACATAAGTAGCTGGG - Intergenic
1107365320 13:39666555-39666577 GGATGTAAAACTAAGGAGTTGGG - Intronic
1109254453 13:60061956-60061978 GGATTTGAACATTTGGAGGTGGG - Intronic
1109753315 13:66724754-66724776 GGTTGTTAACATAGGGAAGCTGG - Intronic
1111461273 13:88545573-88545595 GTATGATGACATTAGGAGGTGGG + Intergenic
1111975385 13:94961918-94961940 GGTTGTGAAGACAAGGAGGTGGG + Intergenic
1112179943 13:97068719-97068741 GGATGCTAACACAAGAAGGCTGG + Intergenic
1112896556 13:104306448-104306470 GGATTTTAACATATGAAGTTTGG - Intergenic
1115565702 14:34623409-34623431 GAATGTTAGCCTAAGGAGTTTGG + Intronic
1116916324 14:50529710-50529732 GGATGTGAAAAAAAGGAGGAAGG + Intronic
1120325669 14:83022239-83022261 AGATGTTGAAATAAGGAGGCTGG - Intergenic
1124247698 15:28085020-28085042 GGGTGTGAACACCAGGAGGTGGG + Intronic
1125921370 15:43527695-43527717 GGATGTTACCATTAAGAGGGGGG - Exonic
1126320595 15:47418629-47418651 GGATTTCAACATAAGGATTTTGG + Intronic
1130031778 15:80321304-80321326 GGATGTGAATACGAGGAGGTAGG + Intergenic
1130714544 15:86319089-86319111 GGATGTTATCAAAAGTAGATTGG - Intronic
1133804438 16:9113948-9113970 GGATTTCAACATGAGGGGGTAGG + Intronic
1134276849 16:12783992-12784014 GGATGTGAATATCAGGAGGCAGG - Intronic
1136476288 16:30515658-30515680 GGATTTTAACAGATGAAGGTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1139332260 16:66202467-66202489 GGATGACATCATAAGGAGGGGGG - Intergenic
1143916442 17:10296872-10296894 AGAAGTTAACATATGGAGTTGGG - Intergenic
1147690792 17:42313160-42313182 GGTGGCTAACATAAGGGGGTTGG + Intergenic
1152102631 17:78311518-78311540 GGATTTTAACATAAGGAATCAGG + Intergenic
1152682700 17:81677327-81677349 GCATGAAAATATAAGGAGGTAGG - Intergenic
1154062293 18:11073234-11073256 GGATGTGAACACAAGGAGATGGG - Intronic
1156200174 18:34821776-34821798 GCATGTTGACATCAAGAGGTGGG + Intronic
1157843332 18:50979638-50979660 GGACGTGAACACCAGGAGGTAGG + Intronic
1158795351 18:60839184-60839206 GGATGTGAATACAAAGAGGTGGG + Intergenic
1159460587 18:68717870-68717892 GTATGATAACATTAAGAGGTGGG + Intronic
1160581281 18:79885799-79885821 GGATGGGAACATAGGGACGTGGG + Intronic
1160581301 18:79885856-79885878 GGATGGGAACATAGGGACGTGGG + Intronic
1160581340 18:79885969-79885991 GGATGGGAACATAGGGACGTGGG + Intronic
1160581356 18:79886026-79886048 GGATGGGAACATAGGGACGTGGG + Intronic
1160581376 18:79886083-79886105 GGATGGGAACATAGGGACGTGGG + Intronic
1160581396 18:79886140-79886162 GGATGGGAACATAGGGACGTGGG + Intronic
1160581416 18:79886197-79886219 GGATGGGAACATAGGGACGTGGG + Intronic
1160581436 18:79886254-79886276 GGATGGGAACATAGGGACGTGGG + Intronic
1160581456 18:79886311-79886333 GGATGGGAACATAGGGACGTGGG + Intronic
1160581476 18:79886368-79886390 GGATGGGAACATAGGGACGTGGG + Intronic
1160581496 18:79886425-79886447 GGATGGGAACATAGGGACGTGGG + Intronic
1160581512 18:79886474-79886496 GGATGGGAACATAGGGACGTGGG + Intronic
1160581532 18:79886531-79886553 GGATGGGAACATAGGGACGTGGG + Intronic
1160581552 18:79886588-79886610 GGATGGGAACATAGGGACGTGGG + Intronic
1160581572 18:79886645-79886667 GGATGGGAACATAGGGACGTGGG + Intronic
1160581589 18:79886702-79886724 GGATGGGAACATAGGGACGTGGG + Intronic
1160581605 18:79886751-79886773 GGATGGGAACATAGGGACGTGGG + Intronic
1160581625 18:79886808-79886830 GGATGGGAACATAGGGACGTGGG + Intronic
1160581645 18:79886865-79886887 GGATGGGAACATAGGGACGTGGG + Intronic
1160581665 18:79886922-79886944 GGATGGGAACATAGGGACGTGGG + Intronic
1160581682 18:79886979-79887001 GGATGGGAACATAGGGACGTGGG + Intronic
1160581701 18:79887036-79887058 GGATGGGAACATAGGGACGTGGG + Intronic
1160799785 19:962430-962452 GGATGTTTACAGAAGGAGCTGGG - Intronic
1163896162 19:20061683-20061705 GGATTTTAGCATGAGGAGGAAGG + Intergenic
1165163736 19:33834979-33835001 AGATGGTAACAGAAGGAGGTTGG + Intergenic
1167101158 19:47404962-47404984 GGATGCTAAACTAAGGAGTTAGG + Intronic
1168019705 19:53600339-53600361 GGATGTTTTCATGAGGAGTTTGG + Exonic
1168715669 19:58525691-58525713 GGCTGTTAACAAAGGCAGGTGGG + Intronic
930376223 2:50570455-50570477 ATATGTTAGCATAAGGAGGAAGG - Intronic
930996778 2:57729035-57729057 AGATGTGAATATCAGGAGGTAGG + Intergenic
932504256 2:72213644-72213666 GGATTTCATCATAAGGATGTTGG - Intronic
933935551 2:87200784-87200806 GGAGCTTAACATAAGGATGGAGG + Intergenic
936042055 2:109157576-109157598 GGTTGTTAAAAGAAGGAGATTGG + Intronic
936357598 2:111765115-111765137 GGAGCTTAACATAAGGATGGAGG - Intergenic
940886203 2:158991360-158991382 AGATGTTAAAAGAATGAGGTAGG + Intronic
941469996 2:165872671-165872693 GGATGTCAACATACGAAGTTTGG + Intronic
943816198 2:192258768-192258790 GGACATCAATATAAGGAGGTGGG + Intergenic
944332969 2:198494154-198494176 GGATGTGCACATACGGAGGAAGG - Intronic
945731223 2:213537852-213537874 GTATGTTAACATCAGGAAGCAGG - Intronic
946137303 2:217657767-217657789 GGAGGTTAAAATAAGGGGCTAGG + Intronic
946606632 2:221412106-221412128 GGAAGATAACATAAGGATTTGGG + Intergenic
947919367 2:233855789-233855811 GGATGTTTATATAGGGAGGAAGG - Intergenic
948272702 2:236686662-236686684 GGATGTTCAGATAAGGGGGCAGG - Intergenic
1171953700 20:31443034-31443056 GGATAGGAACATAAGGAGGTGGG + Intronic
1172513184 20:35514672-35514694 GTATGTTGAGATAAGGAGGGTGG + Exonic
1172801079 20:37576712-37576734 GGATGATAAGAGAAGGAGGGAGG - Intergenic
1173093689 20:40002675-40002697 AGATGTTAACATTAGAAGCTAGG - Intergenic
1173366494 20:42390491-42390513 GGATGTGAATAACAGGAGGTAGG - Intronic
1177673854 21:24271037-24271059 GGCTGTTAACTTAAAGAGATAGG - Intergenic
1178994421 21:37385631-37385653 GGATGTGAACACTAGGAGGTGGG + Intronic
1183910656 22:41076376-41076398 GGATGTGGACACTAGGAGGTGGG + Intergenic
949151050 3:767349-767371 GGGTCTGAACACAAGGAGGTGGG + Intergenic
951401237 3:22233765-22233787 GAATGTTCAAATAAGTAGGTGGG - Intronic
951912418 3:27765317-27765339 GGATTTTAACATAAGGTCCTTGG - Intergenic
951933042 3:27991276-27991298 GGATGTTCATGTAAGCAGGTGGG - Intergenic
953747708 3:45587729-45587751 GGATTTTAACATATGAATGTTGG - Intronic
955200171 3:56844827-56844849 GGATGTGAACACCAGGAGGCAGG - Intronic
956771242 3:72527764-72527786 GGATGGTAAAATACTGAGGTTGG + Intergenic
962918463 3:139930096-139930118 GGATGCTCACATATGGAGGCTGG - Intergenic
963337075 3:143987678-143987700 GGATATTAAAGGAAGGAGGTGGG - Intronic
964277312 3:155022165-155022187 AGATGTTCATATTAGGAGGTGGG - Intergenic
964762273 3:160145780-160145802 GGATTTCAACATAAGGATTTTGG + Intergenic
964783741 3:160371060-160371082 GGATGTTAAAAGAAGGGGTTTGG - Intronic
965064401 3:163828524-163828546 GGATATTAACATAAGGACATAGG - Intergenic
967253099 3:187563196-187563218 AGATGTGAACACCAGGAGGTGGG + Intergenic
967906715 3:194507660-194507682 GGATGTCAGGAGAAGGAGGTAGG - Intergenic
968319915 3:197757095-197757117 GGATGATAAGATAAGGAGTCTGG - Intronic
969427228 4:7132229-7132251 GGATGTTAACGTGAGGGGGCTGG + Intergenic
971108774 4:23558526-23558548 AGATGTTAAAATAAGGAGATTGG + Intergenic
971827530 4:31645691-31645713 GGATTTTAACATATGGATTTGGG - Intergenic
972369044 4:38404460-38404482 GGATGTGAATATCAGGAAGTGGG + Intergenic
974112633 4:57543261-57543283 AATTGTTAACATAATGAGGTGGG - Intergenic
975248311 4:72146584-72146606 GGATTTTAACACAAGTAGTTTGG - Intronic
977038787 4:91987316-91987338 GGATTTTAACATATGAAAGTTGG + Intergenic
977378729 4:96242227-96242249 GGATGTTAAGATCATGAGGCAGG + Intergenic
978297721 4:107226900-107226922 GGATCTTAACACAAGGAGTTTGG - Intronic
978501039 4:109410307-109410329 GGAGGTTGAAATAAAGAGGTTGG - Intergenic
981259612 4:142704110-142704132 GGATGGCAAGATAAGGAGGCCGG + Intronic
982147833 4:152417215-152417237 GGATGTTAAAATAATGAATTTGG - Intronic
982823017 4:159967606-159967628 GGATGATAACATCAGCAAGTTGG - Intergenic
987731285 5:21775945-21775967 GGGTGTGAATATCAGGAGGTGGG - Intronic
988238249 5:28574806-28574828 GAATGTTAACATCAGGAGTCAGG - Intergenic
992246248 5:74826709-74826731 GGATGTTAACATTAGGGTGAAGG - Intronic
992607534 5:78474260-78474282 GGATTTTAACATAAGAATTTTGG + Intronic
993978328 5:94510957-94510979 GGATTTTAACATAAGAATTTTGG - Intronic
994383661 5:99102261-99102283 GGGTGTAAACACCAGGAGGTGGG - Intergenic
998595137 5:143521571-143521593 GGATGAGAACACAAGGTGGTGGG - Intergenic
1006683581 6:35814432-35814454 GGCTGTTAACAGAAGGAGAAGGG + Intronic
1007602717 6:43093091-43093113 AGATGTTTACAAGAGGAGGTAGG + Intronic
1012434022 6:99195838-99195860 AAATGTTAACATCAGAAGGTGGG + Intergenic
1012924980 6:105258580-105258602 GGACATTAACAGAAGGAGGCAGG - Intergenic
1014844157 6:126255727-126255749 GGATGTTAAAAAAATGAGGAAGG + Intergenic
1016177850 6:141101812-141101834 GCACATTAACTTAAGGAGGTAGG + Intergenic
1016192025 6:141281106-141281128 GTATGTTTACATAAGCAGTTTGG - Intergenic
1016757044 6:147698311-147698333 AGATGATAACATTAGGAGGTGGG - Intronic
1017112917 6:150949512-150949534 GGAAGTGAACAGAAGAAGGTGGG - Intronic
1018645601 6:165945012-165945034 GGATGTGAACACCAGGAGATGGG - Intronic
1018996066 6:168711552-168711574 GCATGTTAACTTAAAGAGGGGGG - Intergenic
1022368595 7:29749590-29749612 GGACGTACACACAAGGAGGTGGG - Intergenic
1022742143 7:33132730-33132752 AGATATTAAGATAAGCAGGTAGG - Intronic
1023483718 7:40662120-40662142 GGATGTTAGCTTAAGAAAGTAGG - Intronic
1024515919 7:50255895-50255917 AGATGTTAGCATAAGGAGACAGG - Intergenic
1026037252 7:66838517-66838539 GGATGTGAACTCCAGGAGGTGGG + Intergenic
1027470223 7:78564548-78564570 GGTTTTTAACGTAAGGAGTTAGG + Intronic
1028455832 7:91036955-91036977 GGTTGTGAACAGCAGGAGGTGGG + Intronic
1033003685 7:137536733-137536755 GGATGTTACCATAAGGAAAGAGG + Intronic
1039919221 8:41881698-41881720 GGATGTTAAAATCAGGCGGCTGG + Intronic
1043490508 8:80743518-80743540 GGATGTTCAGAGAAGCAGGTGGG + Intronic
1044162622 8:88938533-88938555 AAATGTTAACATAAGGAAATGGG - Intergenic
1045706334 8:104927261-104927283 GGTTGTTTATATAAGGAAGTGGG - Intronic
1047236051 8:123042677-123042699 GGATGTTAAGATCAGGAGAGAGG - Intronic
1047326328 8:123839836-123839858 GCATGTTAACATATGGAGTATGG + Intergenic
1047357418 8:124136603-124136625 GGATATTAACAAAAGGTGCTGGG - Intergenic
1050235450 9:3574457-3574479 TAATGTTAACAAAAGGAGGGGGG - Intergenic
1050280082 9:4041231-4041253 GGTTGTTAAAACAAGGGGGTGGG + Intronic
1050403798 9:5285338-5285360 GGATGGCAGCATAGGGAGGTAGG - Intergenic
1050759697 9:9052264-9052286 AGATGTTGATATTAGGAGGTGGG - Intronic
1052149800 9:25101848-25101870 GGATATGAACATACGGGGGTGGG + Intergenic
1053516779 9:38737140-38737162 GGATGTCAACATAATAAGGAAGG + Intergenic
1055483806 9:76736736-76736758 GGATTTTAACATATGAAGTTTGG + Intronic
1056221670 9:84456007-84456029 AAATGTTAACTTAAAGAGGTGGG + Intergenic
1056939540 9:90943216-90943238 GGTTCTTAACATCAGCAGGTTGG - Intergenic
1059909812 9:119030406-119030428 GGATGTCCACATTAGGATGTAGG - Intergenic
1060843647 9:126816867-126816889 AAATATTAACATAAGGGGGTGGG - Intronic
1061389690 9:130310597-130310619 GGATGTGAACACCAGGAGGCGGG + Intronic
1061389712 9:130310663-130310685 GGGTGTGAACACGAGGAGGTGGG + Intronic
1186544590 X:10435594-10435616 GGGTGTGAACACCAGGAGGTAGG + Intergenic
1187102519 X:16209306-16209328 GAATGTTAATATAGGGAAGTGGG + Intergenic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1188030721 X:25260480-25260502 GGGTGTGAACAACAGGAGGTGGG + Intergenic
1190451146 X:50581987-50582009 GGGTGTGAACACCAGGAGGTGGG - Intergenic
1194002134 X:88443591-88443613 GGATGTAAAGAAAAGGAGTTTGG - Intergenic
1195671078 X:107470667-107470689 GGGTGTGAACATCAGGAGGTGGG + Intergenic
1196593701 X:117518924-117518946 GGATGTCAGCCTAAGGAGATTGG - Intergenic
1198113264 X:133521562-133521584 TGCTGGTAACATAAGGAGGCTGG - Intergenic