ID: 901329345

View in Genome Browser
Species Human (GRCh38)
Location 1:8393035-8393057
Sequence TAGGAGAAGGAGAATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 496}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901329336_901329345 26 Left 901329336 1:8392986-8393008 CCCAATGAAGATGTGCACCAAAA 0: 1
1: 0
2: 0
3: 21
4: 191
Right 901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG 0: 1
1: 0
2: 3
3: 49
4: 496
901329338_901329345 9 Left 901329338 1:8393003-8393025 CCAAAATACCATGATGAAGTTTA 0: 1
1: 0
2: 2
3: 24
4: 479
Right 901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG 0: 1
1: 0
2: 3
3: 49
4: 496
901329337_901329345 25 Left 901329337 1:8392987-8393009 CCAATGAAGATGTGCACCAAAAT 0: 1
1: 0
2: 1
3: 17
4: 190
Right 901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG 0: 1
1: 0
2: 3
3: 49
4: 496
901329339_901329345 1 Left 901329339 1:8393011-8393033 CCATGATGAAGTTTATCCTGAAA 0: 1
1: 0
2: 2
3: 15
4: 243
Right 901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG 0: 1
1: 0
2: 3
3: 49
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901329345 Original CRISPR TAGGAGAAGGAGAATGTGGT GGG Intronic
901183012 1:7354447-7354469 TTGGATAAAGAAAATGTGGTAGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901535800 1:9882451-9882473 GAGGAGAAGGAGGAGTTGGTAGG + Intronic
901685359 1:10940664-10940686 TCGGAGATGTAGAATGTGCTTGG + Intergenic
903567181 1:24276737-24276759 CAGGAAAAGGAGAATGTCCTAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906515100 1:46434200-46434222 TAAGAGAAGGGGTATGTGGATGG - Intergenic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
907484129 1:54765323-54765345 TTAGAGAAGGAGAATGGAGTGGG + Intergenic
908000902 1:59677828-59677850 TAAGAGAAGGAGAATCTGAATGG - Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
909391847 1:75129027-75129049 GAGGTGAAGGAGGATGTGGTAGG + Intronic
909893599 1:81037697-81037719 TAGGAGTATGAGGGTGTGGTGGG - Intergenic
910481038 1:87658750-87658772 TTGGTCAAGGAGAATGTGGGTGG - Intergenic
911085170 1:93970926-93970948 TATGAGCAGCAGAATATGGTGGG - Intergenic
911208155 1:95113515-95113537 TAGGAGATGAAGAACATGGTAGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
912780748 1:112545217-112545239 TAGGAGAGGGGGAATATGCTGGG - Intronic
913057518 1:115176010-115176032 TGGGAATAGGAGAATGGGGTGGG + Intergenic
915023549 1:152805054-152805076 TAGGAGAAGGGGGATGTCCTTGG + Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916860276 1:168796186-168796208 TGGAAGAACTAGAATGTGGTTGG - Intergenic
917217331 1:172691822-172691844 GAGTTGAATGAGAATGTGGTGGG + Intergenic
917439015 1:175049867-175049889 TAGGAGAAGGAGAAGGTGAGGGG + Intergenic
918120829 1:181538642-181538664 AAGGAGAAGGTGACTGTGTTTGG + Intronic
918442715 1:184584073-184584095 AGGGGGAAGGAGAAAGTGGTGGG - Intronic
918814967 1:189170335-189170357 TAGGAGAAAGGAGATGTGGTGGG - Intergenic
918978425 1:191522743-191522765 TAAGAAAAGGAGAATGTGGTCGG - Intergenic
919064942 1:192682851-192682873 TTGGAGCAGGAGAGAGTGGTGGG - Intergenic
919747624 1:201018308-201018330 TAAGAAAGGGAGAATGTGGCTGG + Intronic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920112855 1:203599302-203599324 TAGGGGAAGGAGAAAGGGCTGGG - Intergenic
920335679 1:205243658-205243680 CAGGAGAAGGAGCATGTTTTGGG + Intronic
920856347 1:209665696-209665718 TAGGAAAATGAGAATGCTGTAGG + Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922353001 1:224750164-224750186 TAGGGGAAAGATAATGTGTTCGG + Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923474270 1:234318164-234318186 GAGGAGAGGGTGAATGTGATGGG - Intronic
924227121 1:241931332-241931354 TAGGAAAAAGAGAATGTAATAGG + Intergenic
1065046970 10:21753818-21753840 GAGGAAAGGGAGAAAGTGGTTGG + Intergenic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065822663 10:29540261-29540283 TAGCAGAAGGGGCAGGTGGTAGG - Intronic
1066554000 10:36591117-36591139 AAGGAGCAGGAGAAGGTGCTGGG + Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067571709 10:47376621-47376643 GGGGAGAAGGAGGATGGGGTGGG - Intronic
1068321728 10:55426901-55426923 TGGGTGTAGGAGACTGTGGTTGG - Intronic
1068387952 10:56357866-56357888 AAGGAGGAGGAGAATGTTTTAGG - Exonic
1069219515 10:65865808-65865830 CAAGAGAAGGAGCATGTGTTTGG + Intergenic
1071104958 10:82083666-82083688 TAGGAGGTGGAGGTTGTGGTGGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1072682201 10:97515765-97515787 TGGGAGAAAGAGAGTCTGGTTGG + Intronic
1072844223 10:98811086-98811108 TAAGAGAAGGTTAATGTAGTTGG - Intronic
1073546523 10:104353945-104353967 TAGGAGAGGGACAATGGGGAGGG - Intronic
1073662302 10:105489872-105489894 TAGGAGGAGGAGTGTGTAGTTGG + Intergenic
1073939573 10:108680083-108680105 TAGGTGAAAGAGTAGGTGGTGGG - Intergenic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1075570454 10:123538146-123538168 TAGGAGATGGGGCCTGTGGTAGG - Intergenic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077660888 11:4067580-4067602 TAGCAGAAAGACAATGTAGTTGG + Intronic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078748663 11:14139373-14139395 TAGGAGAAGGACAAAGTGCTGGG - Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1080355866 11:31444907-31444929 TAGGAGATGGAGAAGAGGGTTGG + Intronic
1081752611 11:45522695-45522717 TAGGAGTAGGAGCAGGTGGAGGG + Intergenic
1083659133 11:64244194-64244216 TCGGGAAAGGAGAAGGTGGTGGG - Intergenic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1085168747 11:74429374-74429396 TAGGAGAAAAAGAGTGTGTTTGG + Intergenic
1085491196 11:76919480-76919502 TATTATAAGGAGAATGTGTTTGG + Intronic
1085526446 11:77166876-77166898 AGGGGCAAGGAGAATGTGGTGGG - Intronic
1085684426 11:78608856-78608878 GAGTTGAATGAGAATGTGGTGGG - Intergenic
1085754049 11:79189341-79189363 GAGGAGCAGGAGACTGTGGTGGG - Intronic
1086880337 11:92146386-92146408 TAGGAGCAGGGAAATGGGGTGGG - Intergenic
1086891097 11:92258983-92259005 TAGGAAAGGAGGAATGTGGTTGG + Intergenic
1087104822 11:94398816-94398838 TAGGAAAGGGAGAAGGTTGTGGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088269825 11:108022595-108022617 TAGGAAAAAGAAAATGTGTTTGG - Intronic
1088616014 11:111628924-111628946 TAGGAGTAGGAGAAGGGGTTAGG + Intronic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089710120 11:120308487-120308509 TAGGAGTAGGGGAAAGTGGCCGG + Intronic
1089751677 11:120655830-120655852 TAGGAGGAGGAGCAGGTGGCGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092996868 12:13959109-13959131 TAGGACACAGAGAATCTGGTGGG + Intronic
1093504561 12:19850178-19850200 TGGGAGAAAAAGAATTTGGTAGG + Intergenic
1093692339 12:22122343-22122365 TAGGAGGGGCAGAGTGTGGTTGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095724964 12:45441588-45441610 TAGGAGAATGAGGTTGGGGTGGG + Intergenic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096502175 12:52070663-52070685 TGTGGGAAGGAGAATGGGGTTGG + Intronic
1096755472 12:53796037-53796059 TAAGTGAGGGAGAATGTGGAAGG + Intergenic
1097278822 12:57831816-57831838 GAGGAGGAAGACAATGTGGTAGG + Intronic
1097401298 12:59131219-59131241 GAGGAGAAGGGGACTGTAGTGGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097645086 12:62226673-62226695 TATGAGAGGAAGAATGTGTTTGG - Intronic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097717078 12:62978387-62978409 GAGGTGGAGGAGAATGTGGTGGG + Intergenic
1098221787 12:68277801-68277823 TAAGAGAAAGAGAAGGTGATGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1099059903 12:77894705-77894727 TAGAAGCAACAGAATGTGGTAGG + Intronic
1099804495 12:87500444-87500466 TAGTTGAACGAGAATGTGGTGGG + Intergenic
1102575615 12:113854453-113854475 TGGGGGAAGGAGAATGGGGGTGG - Intronic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102867904 12:116388685-116388707 TAGTAGAAGCAGAAGGTTGTTGG + Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1104968500 12:132520621-132520643 TAGCAGCAGGGGACTGTGGTAGG + Intronic
1106139778 13:27002476-27002498 CAGGAGAGGGTGAATGTGGCTGG - Intergenic
1107247193 13:38310472-38310494 TAGGAGATGGAGTCTTTGGTAGG - Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108256686 13:48618065-48618087 TAAGAGAAGGAGAATGAAGGGGG + Intergenic
1108878633 13:55081079-55081101 TAGCAGAATGAGATTGTTGTTGG + Intergenic
1110182956 13:72638952-72638974 TAGGAAGGGGAGAGTGTGGTGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111363929 13:87215321-87215343 TAGGAGAGGCTGTATGTGGTGGG + Intergenic
1112336499 13:98521492-98521514 TAGGAAGAGGAGGATGTTGTAGG - Intronic
1113264069 13:108597475-108597497 TAGGAGATGGAGAGTGGTGTAGG - Intronic
1114146152 14:19980352-19980374 TAGGGGAAGGTGTAGGTGGTGGG - Intergenic
1114550875 14:23532203-23532225 TAGGAGAAAGAGAAAGGGTTGGG - Intronic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1115167527 14:30465604-30465626 TAGGATATGGAGAATGAAGTTGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115410577 14:33069472-33069494 TAGGAGAATGTCAGTGTGGTGGG + Intronic
1116259842 14:42611286-42611308 GAGGAGATGGAGATTGTTGTTGG + Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1117223209 14:53628121-53628143 TGGGAGATGGTGGATGTGGTTGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117771219 14:59136257-59136279 TACGAGAATGAGAATGAGATAGG - Intergenic
1117868993 14:60178074-60178096 TATGAGAAAGGGAATGTTGTAGG - Intergenic
1118078557 14:62329960-62329982 GGGAAGAAGGAGAATGTGCTAGG + Intergenic
1118418971 14:65577745-65577767 TAGGAAAAGTAGATTGGGGTAGG + Intronic
1118863310 14:69682700-69682722 TAAGAGAAAGAGAAAGTGGGAGG + Intronic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119358013 14:74023127-74023149 CAGGAGAAAGATAATATGGTAGG + Exonic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121019793 14:90572972-90572994 AAGGAGAAGGGGAAAGTGATGGG - Intronic
1121051284 14:90820477-90820499 TAGGGGAAGGAGACACTGGTGGG + Intergenic
1121943021 14:98091428-98091450 TAGGAGATTAAGACTGTGGTGGG - Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125065027 15:35472382-35472404 TAGGAGCTGGAGAAAGTGGCAGG + Intronic
1125527131 15:40383484-40383506 TAAGGGAAGGACCATGTGGTAGG + Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1128104309 15:65031819-65031841 TATGAGAAGGAGAGTGAGATGGG + Intergenic
1128606947 15:69043634-69043656 TAGGAGAAGCAGAACGTTCTCGG + Intronic
1129005162 15:72366735-72366757 GAGGAGGAGGAGGATGTTGTTGG - Intronic
1130106766 15:80934681-80934703 TAGGAGAGGGAGATGGTGTTGGG + Intronic
1131161344 15:90106897-90106919 TAGGAGGAGGAGAGAGTTGTGGG + Intergenic
1131353123 15:91719466-91719488 TAGGAGAAAGACCATGTGGAGGG - Intergenic
1131600653 15:93845677-93845699 TAGGAGAATGTGAATATGGATGG + Intergenic
1131816952 15:96231923-96231945 TAGGAGGAGGAGAAAGTGGGGGG + Intergenic
1133254559 16:4508709-4508731 TGGGAGAATGAGACTGTGGCAGG - Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133490626 16:6264584-6264606 GAAGAGGAAGAGAATGTGGTGGG - Intronic
1133733182 16:8593483-8593505 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1135686423 16:24501624-24501646 TAGGAGGAGGAGAGAGAGGTGGG - Intergenic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136749379 16:32619345-32619367 TAGGAGAAGGAGGACGTGTCAGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1141035543 16:80622391-80622413 TAGGGGGAGGAGAATAGGGTGGG - Intronic
1141167271 16:81669033-81669055 TGGAAGGAGGAGAGTGTGGTGGG - Intronic
1141703617 16:85653283-85653305 TAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141862528 16:86727729-86727751 AAGGAGAAAGAAAATATGGTCGG + Intergenic
1203051511 16_KI270728v1_random:878559-878581 TAGGAGAAGGAGGACGTGTCAGG + Intergenic
1142698577 17:1646507-1646529 CAGGAGCTGGAGACTGTGGTTGG + Exonic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1143941243 17:10544259-10544281 TTGGGGAGGGAGAAAGTGGTAGG - Intronic
1144673819 17:17148172-17148194 TAGGGGTAGGAGAGTGTGGGCGG + Intronic
1146677880 17:34785951-34785973 TTGCAGGAGGTGAATGTGGTGGG - Intergenic
1146803660 17:35847866-35847888 TAGGGAAAGGCGAATGTGGAGGG + Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147365812 17:39958432-39958454 GAGGGCAAGGAGAATGTTGTAGG - Intergenic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1149003018 17:51776299-51776321 TGGGAGATGGAGATTGTAGTGGG + Intronic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152115823 17:78386451-78386473 TATGGGAAGGAGGAAGTGGTGGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152511897 17:80795646-80795668 TACGAGGAGGAGAGTGTGGTGGG + Intronic
1153533941 18:6080066-6080088 TAAGAGAAGGAGAGGGTGCTTGG - Intronic
1153991098 18:10401480-10401502 GAGTAGATGGAGAATGTGGTAGG + Intergenic
1154463280 18:14617921-14617943 TAGGGGAAGGTGTAGGTGGTGGG - Intergenic
1155119629 18:22805070-22805092 AAGGAGAAGGAGCATGTGTAAGG + Intronic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157233535 18:45941875-45941897 TAGGAGAATGAGACAGTGGGAGG - Intronic
1157303543 18:46498814-46498836 TTGGTGAAGAAGAATTTGGTGGG + Intronic
1158123889 18:54081375-54081397 CAGGAGAAGGAGGATGTCTTGGG - Intergenic
1158686571 18:59620327-59620349 TTGGAGGAGAAGAATTTGGTTGG + Intronic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1159873321 18:73783207-73783229 TAGGAGAAGAAAAAGGTAGTAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1162529840 19:11229432-11229454 GAGGTGAAGGGGTATGTGGTTGG + Intronic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1166154785 19:40902812-40902834 TAGGAAAAAGAGGCTGTGGTAGG + Intergenic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1167980750 19:53272986-53273008 TAGGAGAAGGAGGACATGGAAGG + Intergenic
1168259894 19:55187439-55187461 TAGGAGAAGGGGACTGGGGTGGG + Intronic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
926096930 2:10087448-10087470 CAAGAGAAGGAGAATTTGGATGG - Intergenic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926273459 2:11385670-11385692 TAGGAGAAAGAGCATGTAGGAGG - Intergenic
926396189 2:12445317-12445339 TAGGAGAATGAAAATGTATTTGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926891731 2:17644539-17644561 GAGGAGAAGGAGACTGCAGTTGG + Intronic
926974672 2:18502566-18502588 TAATAGAAGCAAAATGTGGTGGG + Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927291358 2:21408137-21408159 TAGAACTAGGAGAATGTGCTGGG - Intergenic
927711888 2:25331326-25331348 TATGTGAAGGATAATGTGGAAGG - Intronic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
930189090 2:48440196-48440218 TAGGAGTGGGAGAATGAAGTGGG + Intergenic
930194159 2:48492618-48492640 TATGAGAAGTAGAATGTTGTAGG + Intronic
930807532 2:55506068-55506090 CAGGAGAAGGAGACTGCAGTGGG + Intergenic
931201688 2:60103650-60103672 AAGGAGAGAGGGAATGTGGTTGG + Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932822193 2:74911035-74911057 CAGGAGATGGAGGTTGTGGTGGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934818103 2:97347940-97347962 AAGGGCGAGGAGAATGTGGTTGG + Intergenic
934819593 2:97360545-97360567 AAGGGCGAGGAGAATGTGGTTGG - Intergenic
935386505 2:102505039-102505061 AAGGTAAAGGTGAATGTGGTGGG - Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935481026 2:103589882-103589904 TAGGAGAAGGAGTAAATGCTAGG + Intergenic
937135297 2:119546562-119546584 TGACAGGAGGAGAATGTGGTGGG - Intronic
937422650 2:121771395-121771417 TAGGAGAAGGTCATTTTGGTTGG + Intergenic
937854366 2:126661754-126661776 TAAGAGAAGGGGCATCTGGTAGG - Intronic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
939213745 2:139211297-139211319 GAGGTGAATGAGGATGTGGTGGG - Intergenic
939428071 2:142066614-142066636 GAGGAGATGAAGAGTGTGGTAGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941482104 2:166028954-166028976 TGGGACAAGAAGGATGTGGTGGG + Intronic
942250568 2:174044167-174044189 CAGGAGAAGGAGGTTGTGGTGGG + Intergenic
942815671 2:180050934-180050956 TAGGAGTAGGAGAAGGTCCTAGG + Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943649613 2:190442713-190442735 AAGGAGATGTAGAATGGGGTGGG + Intronic
945122280 2:206469255-206469277 CAGGAGAAGGAGGTGGTGGTAGG - Intronic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
945454987 2:210041507-210041529 CAGGAGATTGAGAATGTAGTGGG - Intronic
945528927 2:210925926-210925948 TAGCACAAGGAGACTGTGGCAGG - Intergenic
946030207 2:216697635-216697657 AGGGGGGAGGAGAATGTGGTGGG + Intergenic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947413488 2:229868586-229868608 TGGGAGGAGGAGAATGTTATGGG - Intronic
947894579 2:233657402-233657424 TGGCAGAAGGTGAATGTGGAAGG + Intronic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948100242 2:235367227-235367249 AAAGAGCAGGGGAATGTGGTGGG - Intergenic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
948246081 2:236487345-236487367 TAGGAATAGGAGAAGGTGATGGG - Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
1168764057 20:369837-369859 TCGGAGAAGGTCAATGTGGCTGG - Intronic
1168785189 20:533037-533059 TAGGTGAGAGAGAATGTTGTTGG - Intronic
1169156148 20:3331549-3331571 TAGGAGCAGGAGCATGCTGTGGG - Intronic
1170870459 20:20201381-20201403 TAGGAGAAAGGGGAAGTGGTGGG - Intronic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173966267 20:47115165-47115187 TGGGAGAAGGGTAAGGTGGTGGG - Intronic
1176811245 21:13540452-13540474 TAGGGGAAGGTGTAGGTGGTGGG + Intergenic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180687890 22:17684635-17684657 TGGGAGATGGAGGTTGTGGTGGG - Intronic
1180743142 22:18067627-18067649 GAGCAGAAGGCCAATGTGGTGGG - Intergenic
1181289178 22:21777762-21777784 TAGAAGAATGAGATTGTGGCCGG - Intronic
1182731806 22:32501967-32501989 GAGGAAAAGAAGAAAGTGGTTGG - Intergenic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182922007 22:34088843-34088865 GAGTGGAAGGAAAATGTGGTGGG - Intergenic
1183026249 22:35067782-35067804 TATGAGGAGGAGACTGTGCTGGG - Intronic
1183474619 22:38029223-38029245 TAGGAGATGCAGAATGTCTTTGG + Intronic
1183584585 22:38745618-38745640 TAGGTGACGGTGAAAGTGGTGGG - Intronic
1183895975 22:40969236-40969258 CAGGAGGCGGAGATTGTGGTGGG + Intronic
1184340467 22:43883112-43883134 GAGGACAAGGAGAATGTTCTCGG - Intronic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949705604 3:6813463-6813485 TAGGACTATGAGAAGGTGGTAGG - Intronic
950631464 3:14284846-14284868 GAGCAGCAGGGGAATGTGGTGGG - Intergenic
950647559 3:14386415-14386437 TTGGGGTAAGAGAATGTGGTGGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952932298 3:38369591-38369613 TGGGAGAAGGAGGATGTTTTAGG + Intronic
953839016 3:46373651-46373673 CAGGAGAAGGACAATGTTGTAGG - Exonic
957005489 3:74941124-74941146 TATTTGAAGGAGAATATGGTAGG + Intergenic
957155853 3:76542965-76542987 AAGGAGAATGAGAATGTCGTAGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960285352 3:115822432-115822454 TGGGAGATGGAGGTTGTGGTGGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960518253 3:118625656-118625678 TAGGATAAGGTGTATGTGATTGG - Intergenic
960611991 3:119563095-119563117 TAGGAGGAAGAGTGTGTGGTGGG - Intergenic
961097716 3:124172233-124172255 AAGGCGAAGGGGAATGGGGTAGG - Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962611593 3:137081748-137081770 CTGGGGAATGAGAATGTGGTGGG + Intergenic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963389676 3:144644185-144644207 GAGCAGAAGGAGGGTGTGGTAGG + Intergenic
964002092 3:151787207-151787229 TAGGGGAAGGAGAAAGAGATGGG - Intergenic
964485737 3:157183742-157183764 TAGGAGAAGGTGAATGTTCCAGG - Intergenic
964884893 3:161470708-161470730 TCTGAGAAGGAGAATCGGGTGGG + Intergenic
965349811 3:167598543-167598565 CAGGAGAAAGAGAGTGGGGTGGG - Intronic
965727948 3:171739334-171739356 TGGGAGAAAGAGACTGTGTTTGG + Intronic
965966038 3:174490786-174490808 TGGGTGAAGGAGAAGTTGGTGGG + Intronic
966099384 3:176248196-176248218 TAGCAAAAGGACAATTTGGTAGG - Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967897223 3:194407519-194407541 GAGGAGAGGGAGAGAGTGGTAGG - Intronic
967959446 3:194908723-194908745 TAGGAGGTGGAGCATGGGGTTGG - Intergenic
968046514 3:195626769-195626791 TAGGAGATGGGGCCTGTGGTAGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968308139 3:197663272-197663294 TAGGAGATGGGGCCTGTGGTAGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969544927 4:7819697-7819719 CGGGAGAGGGAGAACGTGGTAGG + Intronic
969888185 4:10235384-10235406 AAGGAGAAGGAGCTTGTAGTGGG + Intergenic
971594454 4:28510878-28510900 TAAAAGAAAGAGAATGTGCTTGG + Intergenic
972200134 4:36704051-36704073 TAGGAGAAAGAGGATGAAGTTGG + Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
974658399 4:64854994-64855016 TAGGAGATGGAGACTGTGGGAGG - Intergenic
975172433 4:71247509-71247531 TCAGAGATGGACAATGTGGTTGG + Intronic
975733817 4:77362975-77362997 AAGTTGAATGAGAATGTGGTGGG + Intronic
977171904 4:93772632-93772654 GAGGAGAGGGAGAAGGTGGGAGG - Exonic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
979605401 4:122633127-122633149 TAGGTAAAGGAAAATGTGGGTGG - Intergenic
980411007 4:132419133-132419155 TAGAAGATCAAGAATGTGGTTGG + Intergenic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980783926 4:137528217-137528239 TAGGACAAGAAGAAAGGGGTGGG - Intronic
981005944 4:139875314-139875336 CAGGAGAAGGTGGAAGTGGTGGG + Intronic
981080430 4:140634462-140634484 AAGGGGGAAGAGAATGTGGTGGG - Intronic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
981374001 4:143992597-143992619 TAGGGGAAGGGAATTGTGGTTGG + Intergenic
982051149 4:151503630-151503652 TAAGAGAAAGAGAATGAGTTGGG - Intronic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
983007869 4:162507564-162507586 TAGGAGATAAAGGATGTGGTAGG - Intergenic
983674394 4:170275334-170275356 TTGGAGAATGAGAATCTGTTGGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
985971169 5:3379769-3379791 TAGGAGTTGGGGAAAGTGGTAGG - Intergenic
986790663 5:11156430-11156452 CAGCAGAAGGAGCATGTGGTAGG - Intronic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
987317421 5:16736740-16736762 AAGAAGAAAAAGAATGTGGTAGG + Intronic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987736849 5:21857192-21857214 TAAGAGCAGGAGGTTGTGGTTGG + Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992750326 5:79855330-79855352 AAGGAGAAAGAGAATGTAGGTGG + Intergenic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
995199780 5:109413127-109413149 TAGGGGAAGTAGAATGGTGTTGG + Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996698186 5:126422268-126422290 TGGGAGATGGAGGTTGTGGTGGG - Intronic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997198001 5:131992425-131992447 TAGGCAAAGGAGACAGTGGTAGG - Intronic
997808920 5:136947574-136947596 TAGGATAAAGAAAATGTGGGGGG - Intergenic
998005943 5:138657099-138657121 GAGGGGAAGGTGAATGTGGCTGG + Intronic
998393218 5:141801169-141801191 TTGGAGATGGAGATTGTGTTGGG + Intergenic
998624152 5:143826311-143826333 TTGGGGAAGGAGAATGTTGGGGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999751622 5:154631919-154631941 GAGGAGGAGGAGAAGGTGATGGG + Intergenic
1000042428 5:157494747-157494769 TTCGAGAAGGTGAATGTGGCAGG - Exonic
1000188866 5:158888862-158888884 TAGCAGGAGGAAAATCTGGTGGG - Intronic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001275116 5:170345085-170345107 TAGGAGAAGGACATGATGGTTGG + Intergenic
1001442202 5:171751514-171751536 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001442551 5:171755480-171755502 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1001890316 5:175333008-175333030 CACAAGAAGGAGACTGTGGTGGG - Intergenic
1002093640 5:176818376-176818398 TAGCAGAAGGAGAATGAATTTGG - Intronic
1004175789 6:13338961-13338983 TAGGAGAAGTAGCATGTCTTAGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1006189474 6:32198804-32198826 TAGGGGAAGGAGAGAGGGGTGGG - Intronic
1006562435 6:34925365-34925387 GAGGGGAAGGAGAGTCTGGTTGG + Intronic
1006848547 6:37080558-37080580 CAGGAGGAGGAGGTTGTGGTGGG + Intergenic
1007079617 6:39090094-39090116 TAGGGGCATGGGAATGTGGTTGG - Intergenic
1008067250 6:47062522-47062544 GAGGAAAAGGAGAATGTACTGGG - Intergenic
1009317076 6:62233243-62233265 GAGGAGAAGGAGATTATTGTTGG - Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010908008 6:81516848-81516870 AAGGAAAAGGAGAATGGAGTGGG + Intronic
1011217692 6:85022421-85022443 TGGGAGAAGCTGAATCTGGTGGG + Intergenic
1011440817 6:87385210-87385232 TAGCTGAAAGAGAATATGGTTGG - Intronic
1011708498 6:90027250-90027272 TGGGAGAAAAAGAATGTGCTTGG + Intronic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1014753424 6:125277845-125277867 TGGGAGGTGGTGAATGTGGTGGG + Intronic
1014990868 6:128074760-128074782 TAACAGAAGGACAATGTGGTTGG + Intronic
1015184450 6:130398204-130398226 TAGAAGTAGGAACATGTGGTTGG + Intronic
1015218808 6:130780911-130780933 TAGGAGAATGAGGGTGTGGCGGG + Intergenic
1015343229 6:132126498-132126520 TAGGAGAGGGAGCCTTTGGTAGG - Intergenic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017070422 6:150571082-150571104 TATTAGGAGGACAATGTGGTAGG - Intergenic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1019057826 6:169235878-169235900 TGGGGGAGGGAGAATGTGGATGG - Intronic
1020750441 7:12134211-12134233 TATGAGCAGGAGAAAGGGGTTGG + Intergenic
1020835082 7:13139113-13139135 CAGGAAAAGGTTAATGTGGTAGG - Intergenic
1021110135 7:16684293-16684315 TTGGAGATGGAGACTGTTGTAGG + Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021680196 7:23122345-23122367 AAGGAGAGGGAGAAAGGGGTGGG - Intronic
1021920399 7:25479332-25479354 AACGAGAAGGAGATTGTTGTGGG + Intergenic
1022264370 7:28739686-28739708 TGGGAAAAGGAGAATTTGGAGGG + Intronic
1022395615 7:29985762-29985784 GGAGAGAAGGAGTATGTGGTGGG - Intronic
1023026342 7:36053865-36053887 GAGGAGAAGAAGAATGTAGGAGG - Intergenic
1023228680 7:38000555-38000577 TGGGAGAAGGAGAATATGAGAGG + Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023499346 7:40831304-40831326 GAGGAGAAGGTGAAAGTGCTGGG - Intronic
1024930908 7:54665701-54665723 TAGGAGGTGGAGACTTTGGTAGG + Intergenic
1024955136 7:54910519-54910541 TAGGAGCAGGAAAAAGGGGTAGG + Intergenic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1027233390 7:76284472-76284494 TAGAAGTAGGACAATTTGGTCGG - Intronic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028592413 7:92511988-92512010 GAGGAAAGGGAGAATGGGGTTGG - Intronic
1028847696 7:95500645-95500667 AAGAAGAAGGAGAATATGCTGGG - Intronic
1028988601 7:97026518-97026540 TGGGAGAAGGAGAATGCTGCTGG - Intergenic
1030093850 7:105880406-105880428 TAGGAAAATGACAGTGTGGTTGG + Intronic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032616503 7:133478052-133478074 TAGTAGAAGGAAAAGGTAGTTGG + Intronic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1033082132 7:138308458-138308480 TAGGGGAGGGGGAGTGTGGTGGG + Intergenic
1034001022 7:147413388-147413410 AAGGAAAATGAGAATGTGGTAGG + Intronic
1034010833 7:147527836-147527858 TAGGAGAAGGATTATTTGGGAGG + Intronic
1034171045 7:149063416-149063438 CAGGAGTAGGAGAATCTGGATGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034859262 7:154582009-154582031 GAGGAAAAGGAGGCTGTGGTAGG - Intronic
1034994994 7:155571545-155571567 GAGGAGAAGGAGAGTGGGATAGG - Intergenic
1035311950 7:157975095-157975117 CAGGAGGAGGAGAATGTGCTGGG - Intronic
1035779288 8:2215223-2215245 CATGAGCAGGAGGATGTGGTGGG - Intergenic
1036662342 8:10716347-10716369 CAGGAGCAGGAGGATGTGGCTGG - Intergenic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1039031305 8:33312470-33312492 TAGGAGAGGGGGGATGTGGAAGG - Intergenic
1039100507 8:33936797-33936819 TAGGTGAAGCAGAATTTGGTGGG + Intergenic
1039111276 8:34043050-34043072 GAGGAGGAGGAGAATGTGCCAGG + Intergenic
1039397725 8:37241245-37241267 TGGGGGAAGGTGAATGTGTTAGG + Intergenic
1039432695 8:37537652-37537674 TGAGAGAAGGCGCATGTGGTTGG + Intergenic
1039641790 8:39230935-39230957 TTGGAGAAGGTAACTGTGGTAGG + Intronic
1039842287 8:41302800-41302822 CAGGAGAAGGAGGAGCTGGTGGG - Intronic
1039947747 8:42144509-42144531 CAGGAGGAGGAGATTGTGGATGG - Intergenic
1040735427 8:50501306-50501328 AAGGAGAAGGAAAATCTGATTGG - Intronic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042878446 8:73461694-73461716 TAGGAGGGAGAGAATGAGGTGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044728540 8:95212461-95212483 AAGGAGAAGGAGAAGGTGATGGG + Intergenic
1045250229 8:100476706-100476728 TTGGAGAAGGAGCATCTGGTTGG + Intergenic
1045508271 8:102794192-102794214 TGCGGGAGGGAGAATGTGGTAGG + Intergenic
1046204561 8:110975757-110975779 TAGGAGAAGGAAAAGCTGATTGG + Intergenic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1047401178 8:124548844-124548866 TGGGAAAGGGAGAGTGTGGTTGG + Intronic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1047612721 8:126536950-126536972 TAGGAGACTGAGACTGAGGTGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048535906 8:135294302-135294324 TAGGAGAAGGAAAGTGTGTTGGG - Intergenic
1049986268 9:954574-954596 TTGGAGGAGGAGAAGTTGGTAGG + Intronic
1050934323 9:11375394-11375416 GAGGAGAAGAAGGAGGTGGTAGG + Intergenic
1051552622 9:18346904-18346926 TGGAAGGAGGAGAATGTGCTGGG - Intergenic
1051658227 9:19402905-19402927 TAGAAAAAGGAGAGTGTTGTGGG + Intergenic
1051818823 9:21141169-21141191 TGGGAGAAGGAGAATCTGCTGGG - Exonic
1051843127 9:21420614-21420636 TGGGAGAGGGAGAATCTGCTGGG + Intronic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052734978 9:32332703-32332725 TGGCAGAAGCAGAATATGGTTGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053441613 9:38120939-38120961 GAGGAGGAGGAGAAGGTGGGAGG + Intergenic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1058060677 9:100492631-100492653 TAGGAGAAGGAAAAAGGAGTGGG + Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059663169 9:116421462-116421484 AGGGAGATGGAGAATGTGTTTGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060214076 9:121727856-121727878 TGGGAGAAGGAGATGGAGGTGGG - Intronic
1060527196 9:124327306-124327328 GAGGAGAAGGAGATTGGTGTGGG - Intronic
1061775187 9:132958257-132958279 GAGGAGAAAGAGGATGTGTTAGG + Intronic
1061920426 9:133779577-133779599 AAGGGGATGGAGAACGTGGTGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185660380 X:1723278-1723300 TAGTGGATGGAGTATGTGGTAGG + Intergenic
1185694109 X:2182080-2182102 TTGGAGAAGGAGAATTTAATGGG + Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190310003 X:49110528-49110550 TAAGTGAGGGAGAAGGTGGTAGG - Intergenic
1190559723 X:51675070-51675092 TTGGAGAAGGAGAACAGGGTGGG - Intergenic
1190564568 X:51718251-51718273 TTGGAGAAGGAGAACAGGGTGGG + Intergenic
1190914834 X:54803600-54803622 TAGGAGAAAGTAAATGTGCTAGG + Intergenic
1191641625 X:63433576-63433598 AAGGAGGAGGAGACGGTGGTGGG + Intergenic
1192547620 X:72027025-72027047 GAGGAGAAGAGGAAAGTGGTTGG + Intergenic
1193054878 X:77139307-77139329 TAGTAGAAGGAGAACTGGGTTGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193472108 X:81918881-81918903 TAGGTGCAGGAGACTGTGTTTGG + Intergenic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1193865705 X:86727678-86727700 CAGGAGCAAGAGAATGTGATGGG - Intronic
1194843262 X:98771705-98771727 TAGGAGAAGAAGAAAATAGTTGG - Intergenic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195401327 X:104464506-104464528 TGGGAGGAGGAAAATTTGGTTGG + Intergenic
1195414115 X:104602009-104602031 TTGGATAAAGAAAATGTGGTAGG + Intronic
1195457844 X:105089524-105089546 TAGGGGATGGAAAATGAGGTGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1197366056 X:125566072-125566094 TAAGAAAAGTAAAATGTGGTGGG - Intergenic
1197903309 X:131396344-131396366 TAGAAGAAGGCTGATGTGGTCGG + Intronic
1198741166 X:139844603-139844625 TAGGAGAAGGTGAATGTCTGAGG - Intronic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1200036153 X:153332651-153332673 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1200040805 X:153366267-153366289 TAGGAGAAAGAGAAAGTGTGGGG - Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200972939 Y:9176071-9176093 TAGGAGAAGGCCAAAGTGTTTGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1202138136 Y:21688437-21688459 TAGGAGAAGGCCAAAGTGTTTGG - Intergenic