ID: 901329411

View in Genome Browser
Species Human (GRCh38)
Location 1:8393534-8393556
Sequence GTTGGTTTTCTAACAGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901329402_901329411 17 Left 901329402 1:8393494-8393516 CCCCTTTCCAAGTCCTGTTTAAT 0: 1
1: 0
2: 2
3: 20
4: 239
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
901329401_901329411 18 Left 901329401 1:8393493-8393515 CCCCCTTTCCAAGTCCTGTTTAA 0: 1
1: 0
2: 1
3: 23
4: 253
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
901329404_901329411 15 Left 901329404 1:8393496-8393518 CCTTTCCAAGTCCTGTTTAATTC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
901329406_901329411 4 Left 901329406 1:8393507-8393529 CCTGTTTAATTCTACTCATAAAA 0: 1
1: 0
2: 2
3: 14
4: 285
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
901329405_901329411 10 Left 901329405 1:8393501-8393523 CCAAGTCCTGTTTAATTCTACTC 0: 1
1: 0
2: 1
3: 16
4: 185
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
901329403_901329411 16 Left 901329403 1:8393495-8393517 CCCTTTCCAAGTCCTGTTTAATT 0: 1
1: 0
2: 4
3: 40
4: 379
Right 901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901329411 Original CRISPR GTTGGTTTTCTAACAGCTCA AGG Intronic
901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG + Intronic
901649519 1:10735645-10735667 GTGGGTTCTCTGAGAGCTCAGGG - Intronic
904347890 1:29885178-29885200 GTAGGTTCTCCAACAGGTCAGGG + Intergenic
906851189 1:49251734-49251756 CTTTGTTTTCTAGCTGCTCAAGG - Intronic
908154857 1:61342255-61342277 TTTGGTTTCCTAATAGCTAATGG + Intronic
910726761 1:90348170-90348192 ATTTGTTTTCTCACAGCTCTGGG + Intergenic
911333609 1:96554613-96554635 GTTGGTGCTCAATCAGCTCAGGG - Intergenic
911482489 1:98461472-98461494 GTAGCTTTGCTATCAGCTCATGG + Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
914447966 1:147766182-147766204 GTTTGTCTTCAAAGAGCTCAGGG - Intronic
918558911 1:185840553-185840575 GTGCATTTTCTTACAGCTCATGG + Intronic
919723145 1:200862448-200862470 GTAGGTCTTCTAGCAACTCAAGG + Intergenic
922484302 1:225961645-225961667 GTTGATGTTCTCACATCTCATGG - Intergenic
922582361 1:226708340-226708362 GTTGGTAGAATAACAGCTCAAGG + Intronic
924291725 1:242543328-242543350 GTTGGATATCTAAAAGCTCCTGG + Intergenic
1063346269 10:5315005-5315027 TTTGCTTTTCTAACTGCTAATGG - Intergenic
1066071784 10:31823026-31823048 GTTGATTTTTTAAATGCTCAAGG + Intronic
1070051032 10:72890100-72890122 CTTGCATTTCTAACAGCTCCAGG - Intergenic
1072129262 10:92477076-92477098 GTTGGTGTTCCAAAAGCTAATGG + Intronic
1072990921 10:100192620-100192642 GTCGCTTTTCTCACAACTCATGG - Intronic
1073654147 10:105394260-105394282 GTTTATTTTCCAACATCTCAGGG + Intergenic
1074628734 10:115224402-115224424 GTTCTTTTTCTAACTTCTCAAGG - Intronic
1078879671 11:15435964-15435986 TTTGGTTTCCTAACAACTCAGGG + Intergenic
1083971206 11:66076844-66076866 GTTGGTCTTCTTCCAGCACAGGG + Intronic
1085761048 11:79241842-79241864 GCTAGTTTTTTACCAGCTCAGGG - Intronic
1088608851 11:111557768-111557790 GTGGGTTCTCTGACAGGTCAGGG + Intronic
1088611248 11:111579292-111579314 TTTTGTTTTCTTACAGCACATGG + Intergenic
1089908336 11:122069124-122069146 GCTGGTATTCTAACAGCTCAAGG + Intergenic
1089918089 11:122179023-122179045 GTGGGTTTTCTTAAAGTTCAAGG - Intergenic
1091076755 11:132625693-132625715 GTCTGTTTTCAAACAGCTCATGG - Intronic
1096402985 12:51323038-51323060 TTTGGTTTTCTAAGAGCTGATGG - Intronic
1096481786 12:51946829-51946851 ATTGTTGTTCAAACAGCTCAAGG - Intergenic
1096487361 12:51992572-51992594 GTTTGGTGTCTAACAGCTCTGGG - Intronic
1099006555 12:77240939-77240961 GTTGGTTTTATAGCAGTCCAGGG - Intergenic
1099161825 12:79250912-79250934 GTTGGTTATCTGGCAGCTCAAGG + Intronic
1101887819 12:108683078-108683100 GTTCATTTTCTAACTTCTCAAGG - Intronic
1104541588 12:129670757-129670779 GTTGGTTTTGTAACCACCCAAGG - Intronic
1105531268 13:21222566-21222588 GTTTGTTTTTTTCCAGCTCAGGG - Intergenic
1107981893 13:45741983-45742005 GTTGATTTTCTCAGAACTCATGG - Intergenic
1111163747 13:84429941-84429963 GTTGGTTTTCTAAGGGCACTTGG - Intergenic
1112037567 13:95511356-95511378 GTTTGTTTACTAACAGAACAAGG - Intronic
1114381551 14:22210311-22210333 GTTCCTTTTCTAACAGCTCTTGG + Intergenic
1116159912 14:41254495-41254517 GCTGGCTCTTTAACAGCTCAGGG + Intergenic
1118981647 14:70721909-70721931 GTTGATTTTCACACAGCTCGTGG - Intergenic
1119665527 14:76482491-76482513 GTTGGGTTCCTAAGAGCTCCAGG - Intronic
1126521353 15:49598446-49598468 CTTTGTTTTCTAACTGCTCTAGG + Intronic
1127243235 15:57141969-57141991 TTTGGGTGTTTAACAGCTCAAGG + Intronic
1128232956 15:66048256-66048278 TTTGTTTTACTAACTGCTCATGG + Intronic
1138248973 16:55488084-55488106 GATGGTTCTCAAACTGCTCATGG - Intronic
1138863096 16:60783103-60783125 ATTTGTTTTCTAAAAACTCATGG + Intergenic
1145813689 17:27780804-27780826 GTGGGATTTCGAAGAGCTCAGGG + Exonic
1148022824 17:44564867-44564889 GTTTAATTTCTTACAGCTCAGGG - Intergenic
1160761205 19:785646-785668 GTTAGTTTTCAAACACATCAGGG + Intergenic
1162427428 19:10604799-10604821 GTTGCTTCTCTATCAGCTCACGG - Intronic
1164479942 19:28603432-28603454 ACAGGGTTTCTAACAGCTCAAGG + Intergenic
1168134706 19:54342482-54342504 TTTGGTTTTACAACAACTCAGGG + Intergenic
925902644 2:8519270-8519292 GGTGATTTTCTAAGAGCTCGTGG - Intergenic
926245406 2:11119523-11119545 TTTGTTCTTCTTACAGCTCATGG - Intergenic
926771043 2:16375463-16375485 CTATGTTTTCTAACAACTCAGGG + Intergenic
927383248 2:22503081-22503103 GTTAGTTTTCTATCAACTCCTGG - Intergenic
927749274 2:25652171-25652193 TTTAGTTTTCCAACAGCTCTAGG + Intronic
928299340 2:30111701-30111723 GTTTGTTTTCCTACCGCTCAAGG + Intergenic
929292077 2:40204465-40204487 GTTGTTTTTCTTTCAGCTAAGGG - Intronic
935158592 2:100508174-100508196 TTTGGTTTTCTACCATCTTATGG - Intergenic
935947706 2:108301244-108301266 GGAGGTTTTCTAACAGACCAGGG + Intronic
937399580 2:121570480-121570502 GTTCATTTTCTAACAGCTGCAGG + Intronic
937729696 2:125213647-125213669 GTTGTTTTTCTCACAGGTCTGGG + Intergenic
937748694 2:125447515-125447537 GCTGTGTTTCTAAGAGCTCAAGG + Intergenic
939857173 2:147373060-147373082 TTTTGTTTTCTAAAAGTTCAAGG - Intergenic
940522065 2:154763577-154763599 CTTGGTGTTCTAACAGCTGCTGG - Intronic
940662796 2:156568506-156568528 CTTGTTTTTCTAACTGCTCCAGG + Intronic
941298779 2:163774957-163774979 GTTGGTTTCCTATTAGATCATGG - Intergenic
943458232 2:188135285-188135307 GTTGTTTTGCTGACAACTCAAGG - Intergenic
944358918 2:198828383-198828405 GTGTGTTTTCCAACTGCTCAAGG + Intergenic
944690870 2:202157342-202157364 GTTGGTTTCCACACAGCTCCAGG - Intronic
946484867 2:220091474-220091496 CTTGATTTTCTAATATCTCAAGG - Intergenic
946756437 2:222952354-222952376 GTTGTTTTATTAACTGCTCAGGG - Intergenic
946970729 2:225087969-225087991 GTTGTTTTTCTGACACCTGAAGG - Intergenic
947285565 2:228510822-228510844 GTTTGTTTTCTAACAAGTCATGG + Intergenic
947441976 2:230131433-230131455 GTTTATTTTCTCACAGTTCAAGG + Intergenic
948717931 2:239877540-239877562 GTTGGTTTTCTCCCCGATCAGGG + Intergenic
1171095975 20:22332564-22332586 GCTGGTTTTCTATCACCTCCAGG + Intergenic
1171246263 20:23612185-23612207 GTGGGTCTTCTAACAGCAAACGG - Intergenic
1180710318 22:17835153-17835175 GCTGGTTTCACAACAGCTCAAGG + Intronic
1180710327 22:17835227-17835249 GCTGGTTTCACAACAGCTCAAGG + Intronic
1180744385 22:18077839-18077861 GTTTGTTTTCTCACGGCACAGGG + Intergenic
949494842 3:4621759-4621781 GTCAGTTTTCTTCCAGCTCAGGG + Intronic
949642792 3:6057931-6057953 CTTGGTTTTATAGCTGCTCAAGG - Intergenic
950971101 3:17188859-17188881 GTTGGTTTCATAAAACCTCAAGG - Intronic
951409293 3:22342709-22342731 GTTGGTGTTCTAGCAATTCATGG - Intronic
955654892 3:61234522-61234544 GTTAGTTTTCTAACAGAAAATGG - Intronic
956314357 3:67917382-67917404 CATGGTTTTCTAATAGTTCAAGG - Intergenic
956350476 3:68329645-68329667 ATTGGCTTTCTACAAGCTCAAGG + Intronic
956858989 3:73303938-73303960 GTTGGTTTTCTGAGAGCTGTGGG + Intergenic
957000416 3:74877460-74877482 GTTTGTTTTGTAACATCTGAGGG + Intergenic
961423318 3:126824979-126825001 GTTCTTTTTCTAACTTCTCAAGG + Intronic
964924754 3:161941812-161941834 GCTGATTCTCTAAAAGCTCAGGG - Intergenic
969226625 4:5802840-5802862 GCTGGGTTTCTAACAGGCCAGGG + Intronic
969632943 4:8348961-8348983 ATTTATTTTCTCACAGCTCAGGG + Intergenic
970727979 4:19069734-19069756 CTTGGTTTTCTAACAGCCTGGGG + Intergenic
970845223 4:20529777-20529799 GTTAGTGTTCTAACAATTCAGGG + Intronic
972256801 4:37364507-37364529 GTTGGTTCACTGAGAGCTCAGGG - Intronic
974059105 4:57014003-57014025 GTTAGTTTTCTAAGAACTTAAGG + Intronic
975539013 4:75484851-75484873 GTTTGGTTTTTAACAGCTTATGG - Intronic
976238818 4:82931820-82931842 CTTGCTTTTCTTACAACTCATGG + Intronic
976553527 4:86424098-86424120 GGTGATGTTCTGACAGCTCATGG + Intronic
978422592 4:108549083-108549105 CTTGGTTTTCTAACTCCTCAAGG - Intergenic
978717499 4:111863700-111863722 CTTTGTTTGCTAACAGCACACGG - Intergenic
981078274 4:140612944-140612966 GTTGGTATCCTAACAGGTAAAGG - Intergenic
981780165 4:148420376-148420398 CTTGGTTTGCAAACAGCACAAGG - Intronic
982831037 4:160061085-160061107 GATAGTTCTGTAACAGCTCAAGG + Intergenic
988321789 5:29707461-29707483 GTTAGTTTTCTTACAGCTATAGG + Intergenic
989815184 5:45727698-45727720 GTTTGTTTTTTTACACCTCATGG + Intergenic
990388273 5:55290662-55290684 TTTGGTTTACTAACATGTCAAGG - Intronic
990438422 5:55819154-55819176 CTTAGTTTTCAGACAGCTCAAGG - Intergenic
995911284 5:117190051-117190073 ATTGTTTATCTAACAGATCATGG - Intergenic
997315166 5:132927227-132927249 GTTTGTTTTCAACCAGGTCAAGG + Intronic
998002928 5:138639042-138639064 GATGGTTGTCCAAGAGCTCAGGG + Intronic
998545426 5:143023554-143023576 GTGGGTGTTCTAACAGCAAAAGG - Intronic
1001866152 5:175107215-175107237 TTTGGATTTCTACCAACTCATGG - Intergenic
1003812652 6:9802230-9802252 GTTTGTTTTCTAATATATCAGGG - Intronic
1006093725 6:31643109-31643131 TTTTGGTTTCTTACAGCTCAGGG - Exonic
1006307850 6:33235420-33235442 GTTGATTTTCTTACAGCTGAGGG - Intergenic
1008724217 6:54396423-54396445 TCTGCATTTCTAACAGCTCATGG - Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1010749363 6:79600673-79600695 TTTGGTTTTCTCCCAGCTCCCGG - Intergenic
1012670503 6:102039726-102039748 GCTGCTTTCCTACCAGCTCACGG - Intronic
1014121317 6:117728253-117728275 GATGGTTTTTTAGCAGTTCAAGG + Intergenic
1016211918 6:141547153-141547175 GTTGATTTTCTCACAGTTCTGGG - Intergenic
1018872149 6:167791375-167791397 GTTTGTTTTCAAAAAGCTGAAGG + Intronic
1020222912 7:6255129-6255151 TTCGGTTTTTTAACAGCTTAGGG + Intronic
1021656090 7:22875262-22875284 GTTATTTATCTGACAGCTCAAGG + Intergenic
1024451045 7:49543209-49543231 TCTGGTTTTCTGACAGCTGATGG - Intergenic
1024930595 7:54664025-54664047 GTTGCGTTTCTAAAAGGTCACGG + Intergenic
1026407573 7:70083268-70083290 GATGGTTTTCTAACAGGAGAAGG - Intronic
1027328932 7:77071067-77071089 GTTGGTTTTCTGACAAAACAAGG - Intergenic
1028275628 7:88853269-88853291 TTAGATTTTCTAACAGCTGAAGG + Intronic
1028533687 7:91866898-91866920 GTTTATTTTCTTACAGCTTAAGG + Intronic
1029724403 7:102392766-102392788 GGTGGTTTTCTAGGAGCTCAGGG - Intronic
1029786836 7:102800311-102800333 GTTGGTTTTCTGACAAAACAAGG + Intronic
1030642916 7:112026172-112026194 GTTGGGTTCCTAACAGGCCAAGG - Intronic
1033597956 7:142870050-142870072 GTTTGTATTCTAAGATCTCATGG + Intronic
1034629606 7:152520980-152521002 GCTTGGTTTCTAACAGCTCGAGG + Intergenic
1035474562 7:159133205-159133227 GCTGCTTTTGTAATAGCTCAGGG - Intronic
1036204436 8:6794687-6794709 GTTGGTTTTCCTCCACCTCAAGG - Intergenic
1038178656 8:25205402-25205424 ATGTGTTTTCTAACAGCTCTGGG - Intronic
1044055762 8:87568022-87568044 GATGATTTTTTAACATCTCAAGG - Intronic
1050831017 9:10012998-10013020 TATGCTTTTCTAACAGATCATGG - Intronic
1050958062 9:11689400-11689422 CCTGATTTTATAACAGCTCATGG + Intergenic
1052610774 9:30770760-30770782 ATTGGTTTCCTATAAGCTCAGGG + Intergenic
1052681809 9:31702325-31702347 TTATGTTTTCTAATAGCTCAAGG + Intergenic
1055549858 9:77423044-77423066 GTTGTGTTTCTTAGAGCTCATGG - Intergenic
1055722041 9:79185942-79185964 TTTGCTTTTCTAACAGCTTTTGG - Intergenic
1056290473 9:85138326-85138348 TTTGTTTTTCTCATAGCTCAAGG - Intergenic
1057166077 9:92926638-92926660 TTTTGATATCTAACAGCTCATGG + Intergenic
1059554464 9:115265369-115265391 TCTGGTTTTCTGACAGCTGAAGG + Intronic
1059696664 9:116736376-116736398 TTTGTTTGTCTAACAGGTCATGG + Intronic
1061755681 9:132810705-132810727 GTTGGTTTTTTATGAGGTCACGG - Intronic
1061766611 9:132885634-132885656 GTTTATTTTCCAATAGCTCAGGG - Intronic
1188304451 X:28545513-28545535 GTTGGTTGTAGGACAGCTCATGG - Intergenic
1190650821 X:52566886-52566908 GTTGGTTTTCTCCCACCTCGTGG + Intergenic
1193340237 X:80340209-80340231 GTTTTTTTTCAAACAGCTCTTGG - Intronic
1201020007 Y:9646408-9646430 GTAGGTTTTCTAGCAGCCAAGGG + Intergenic