ID: 901330583

View in Genome Browser
Species Human (GRCh38)
Location 1:8404789-8404811
Sequence CCGTGTCAGGGCGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901330569_901330583 28 Left 901330569 1:8404738-8404760 CCCATACAGCTCCTTACAAGGGT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 207
901330574_901330583 17 Left 901330574 1:8404749-8404771 CCTTACAAGGGTGGGCTAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 207
901330570_901330583 27 Left 901330570 1:8404739-8404761 CCATACAGCTCCTTACAAGGGTG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901330583 Original CRISPR CCGTGTCAGGGCGAGGTGGA AGG Intronic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG + Intronic
902483809 1:16728068-16728090 CTGTGTGAGGCCGAGGCGGATGG + Intergenic
905042496 1:34972195-34972217 CCCTGTCAGGGCTAGGTGATTGG + Intergenic
907213021 1:52839460-52839482 CTGTGGGAGGCCGAGGTGGATGG - Intergenic
908227215 1:62068036-62068058 CTGTGTAAGGCCGAGGTGGGTGG - Intronic
908641893 1:66233119-66233141 TGGTGTCAGGGAGAGGTGGGAGG - Intronic
908738505 1:67302648-67302670 GCGGGGCAGGGCGAGGTGGGAGG + Intergenic
912411553 1:109483885-109483907 CCGCGACGGGGCGAGGGGGAGGG + Intronic
912703693 1:111896700-111896722 CAGTGTCAGGCCAAGCTGGAAGG + Intronic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913131007 1:115838559-115838581 CCGCGCCAGGGCGAGGCGCAGGG - Exonic
917865989 1:179196044-179196066 CTTTGGCAGGCCGAGGTGGACGG + Intronic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
920075670 1:203334693-203334715 CTGTGCCAGGGCGGGGTGGGGGG + Intergenic
921223788 1:212996380-212996402 CCCTGGGAGGCCGAGGTGGACGG + Intronic
921644994 1:217604105-217604127 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
922705548 1:227788414-227788436 GCGTGTCCGGGCGAAGTGGTCGG + Intergenic
922765215 1:228152874-228152896 AGGTGTCAGGGCGAGGTAGGGGG - Intronic
1064648378 10:17483278-17483300 CCGTGGGAGGCCGAGGTGGGTGG + Intergenic
1066190596 10:33052042-33052064 CAGTTTCAGGGTGAGGTTGAAGG + Intergenic
1066628701 10:37436980-37437002 CTTTGGCAGGCCGAGGTGGAGGG - Intergenic
1067039461 10:42941305-42941327 CCGGGCCAGGGAGAGGTGGATGG + Intergenic
1067101747 10:43339230-43339252 CCGAGGCAGGGCCACGTGGAGGG + Intergenic
1068185653 10:53582165-53582187 CCTTCTCAGGGCCAGGAGGAAGG - Intergenic
1070161040 10:73866904-73866926 CAGTGTCAGGGTGAGGTCGGTGG - Intronic
1072423494 10:95309533-95309555 CTGTGGGAGGCCGAGGTGGACGG - Intergenic
1073877350 10:107940478-107940500 CTTTGTGAGGGCGAGGTGGGCGG + Intergenic
1075151571 10:119937380-119937402 CTTTGGCAGGCCGAGGTGGACGG + Intronic
1076984191 11:223597-223619 GGGTGTGGGGGCGAGGTGGAGGG - Intronic
1077918651 11:6626885-6626907 CAGTGGCAGAGCGAGCTGGACGG + Exonic
1078333810 11:10448174-10448196 CAGTGGCAGTGAGAGGTGGAGGG - Intronic
1083996816 11:66276967-66276989 CCATGTCAGGCGGAGGCGGAAGG + Exonic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084031051 11:66480684-66480706 CCGGGGCAGGGCGAGGAGGCTGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085357583 11:75853358-75853380 CCGTCTCAGGGTGGGGTGGGCGG - Intronic
1089343893 11:117777982-117778004 CCATGGCAGGGAGAGGAGGAGGG - Intronic
1091567398 12:1659337-1659359 CCATGTGATGGCGGGGTGGAAGG - Intergenic
1092262743 12:6961222-6961244 CAGGGTCAGGGAGAGGTGGGGGG - Exonic
1093557369 12:20492225-20492247 CTTTGTGAGGGCGAGGTGGGAGG - Intronic
1095614610 12:44173182-44173204 ACGTGGGAGGGCGAGGTGGGAGG - Intronic
1097017625 12:55998535-55998557 CCCTGTCAGGGGCAGGGGGAGGG + Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102084380 12:110124253-110124275 CCGGGCCAGGGCGGGGAGGACGG - Intergenic
1102208378 12:111106233-111106255 CTCTGTGAGGCCGAGGTGGATGG - Intronic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1104524429 12:129505484-129505506 CCGTGGGAGGCCGAGGTGGGCGG - Intronic
1105495527 13:20927495-20927517 CCTTGTGAGGCCGAGGTGGGTGG - Intergenic
1105604511 13:21915761-21915783 CTGTGTGAGGGCGGAGTGGATGG - Intergenic
1108107928 13:47033252-47033274 CAGTTTCAGGGAGAGCTGGAAGG - Intergenic
1108338486 13:49472012-49472034 CTGTGGCAGGCCGAGGTGGGAGG - Intronic
1110887146 13:80654736-80654758 CCCCGTCAGCCCGAGGTGGAGGG + Intergenic
1113879028 13:113612339-113612361 CCCTGTCAGAGGGAGGTGGTGGG + Intronic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115325233 14:32130463-32130485 CCTTGGGAGGCCGAGGTGGAAGG - Intronic
1117606674 14:57436998-57437020 CCTTGGGAGGCCGAGGTGGATGG - Intergenic
1117886336 14:60367948-60367970 CTTTGTGAGGCCGAGGTGGATGG - Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1121310215 14:92931731-92931753 ACGTGTCTGGGAGAGGGGGATGG + Intronic
1122180090 14:99948579-99948601 CTGTGGGAGGCCGAGGTGGATGG + Intergenic
1122937432 14:104966643-104966665 CCCTGGCAGGGCCACGTGGAGGG - Intronic
1124109453 15:26772963-26772985 CCGTGCCGGGGCGCGGCGGAGGG - Exonic
1126816695 15:52460653-52460675 CCGTGCGAGGGCGAGGGCGAGGG + Intronic
1127134316 15:55903914-55903936 CTTTGTGAGGGCGAGGTGGGAGG + Intronic
1127372776 15:58356312-58356334 GGGTGTCAGGGAGAGGAGGAGGG - Intronic
1128111104 15:65076802-65076824 CCGTGCCATGGCGAGCTGGCCGG - Exonic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130411650 15:83653574-83653596 CCGGGTCTGGGCGGGGTGGGTGG + Intergenic
1132116029 15:99137121-99137143 CAGTGCCAGATCGAGGTGGATGG - Exonic
1132616379 16:842924-842946 CCCTGTCTGGTGGAGGTGGATGG - Intergenic
1132899619 16:2246126-2246148 CAGTGTCAGGCCCAGGAGGATGG - Intronic
1134110595 16:11513158-11513180 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
1134545716 16:15106510-15106532 CTCTGGGAGGGCGAGGTGGATGG + Intronic
1135085824 16:19473734-19473756 CCTTGGGAGGCCGAGGTGGATGG + Intronic
1136011037 16:27363528-27363550 CAGTGTCATGGCCAGGAGGATGG + Exonic
1136062210 16:27734453-27734475 CTTTGGGAGGGCGAGGTGGACGG + Intronic
1136228565 16:28874098-28874120 CCGAGGCAGGGTGAGGGGGAAGG + Exonic
1136249919 16:28997709-28997731 CCGCGCCCGGCCGAGGTGGAAGG - Intergenic
1141046239 16:80718565-80718587 CCGTGACAAGGCAAGCTGGATGG + Intronic
1142254640 16:89007812-89007834 CCATGTGAGGGTGAGGTAGATGG - Intergenic
1142785026 17:2214432-2214454 CAGAGTGAAGGCGAGGTGGACGG + Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1147993845 17:44350838-44350860 GCGTGTCAGGGCCAGGTGGCTGG - Intronic
1148127217 17:45243018-45243040 CCTGGTCAGGGCCAGATGGATGG + Intronic
1148688043 17:49511793-49511815 CCGTGTGAGGGCCAGGGGCATGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1150684842 17:67312225-67312247 CCTTGGGAGGCCGAGGTGGATGG - Intergenic
1151631754 17:75315768-75315790 GCGTGTCAGGGAGGGGTGGGGGG + Intergenic
1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG + Intronic
1157357510 18:46949139-46949161 CCGTGGGAGGCCGAGGTGGGAGG - Intronic
1158133893 18:54184415-54184437 CCAGGTGAGGGCGAGGGGGATGG - Intronic
1161328718 19:3676087-3676109 CCGAGGCTGGGAGAGGTGGAAGG + Intronic
1163732861 19:18960075-18960097 CTTTGTGAGGCCGAGGTGGATGG + Intergenic
1164008381 19:21173768-21173790 CCTTGGCAGGTCGAGGTGGACGG - Intronic
1164830078 19:31313603-31313625 GGGTGTCTGGGAGAGGTGGATGG - Intronic
1166231543 19:41427851-41427873 CCCAGTCAGGGTGAGGTGGGGGG + Intronic
1166369133 19:42291648-42291670 GCATGTCAGTGCGGGGTGGAGGG + Exonic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167465184 19:49646799-49646821 CCGTCTCAGGGCCTGGAGGACGG + Exonic
1167931594 19:52870235-52870257 CTTTGTGAGGCCGAGGTGGATGG + Intronic
927024924 2:19057357-19057379 CCTTGTCAGGCTGAGGTGGGAGG + Intergenic
927206696 2:20615687-20615709 CGGTGTCAGGCTGATGTGGAGGG - Intronic
927535942 2:23858724-23858746 CATTGGCAGGCCGAGGTGGAAGG - Intronic
928329589 2:30347337-30347359 ACTTGGCAGGGCGAGGTGGGAGG + Intergenic
928568236 2:32575519-32575541 CTGTGGGAGGCCGAGGTGGATGG + Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
936248905 2:110852257-110852279 CCATTTCATGGCGTGGTGGAGGG + Intronic
938137288 2:128769904-128769926 CAGTGTGAAGGAGAGGTGGAAGG + Intergenic
938900726 2:135796763-135796785 CCGAGCCAGGGCCAGGGGGAGGG - Intronic
940696859 2:156990566-156990588 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
941797963 2:169622175-169622197 CCTTGGGAGGCCGAGGTGGACGG + Intronic
944821924 2:203440555-203440577 CCATGGCAGGGGGAGTTGGAGGG + Exonic
945001897 2:205360660-205360682 CCGTGTCATGGCCAGGTGCATGG + Intronic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948431020 2:237919105-237919127 CTGTGGGAGGGCGAGGTGGGTGG - Intergenic
1168968017 20:1911768-1911790 CCGTCTCAGGGAGAGGAGGGCGG - Intronic
1169118832 20:3083546-3083568 CCGCAGCAGGGCGAGGAGGAAGG - Intronic
1171058132 20:21927874-21927896 CCATCCCAGGCCGAGGTGGATGG + Intergenic
1171190403 20:23155159-23155181 CCGGGGCAGGGGGAGGTGGCGGG - Intergenic
1172626491 20:36350381-36350403 CCTCCTCAGGGCCAGGTGGATGG - Intronic
1173572898 20:44088941-44088963 CCTTGGGAGGCCGAGGTGGATGG + Intergenic
1174339996 20:49889531-49889553 CAGGGTCAAGGCGAGGTGGTAGG - Exonic
1175740185 20:61414621-61414643 CCGTGTGATGGGGTGGTGGAGGG + Intronic
1176413115 21:6459393-6459415 CCGCGACAGGGCCAGATGGAGGG - Intergenic
1177411330 21:20734059-20734081 CCGTGGAAGGCCGAGGTGGGTGG - Intergenic
1177524462 21:22273862-22273884 CCCTGTCAGGGGTAGGTGGCTGG + Intergenic
1178476515 21:32942083-32942105 CCGTGTGTGTGCGAGATGGAGGG - Intergenic
1179688610 21:43067715-43067737 CCGCGACAGGGCCAGATGGAGGG - Intronic
1180668388 22:17533384-17533406 CCGTGGGAGGCCGAGGTGGACGG + Intronic
1180841150 22:18959503-18959525 CCGGGCCAGGGAGGGGTGGATGG - Intergenic
1181060348 22:20279291-20279313 CCGGGCCAGGGAGGGGTGGATGG + Intronic
1183033674 22:35124442-35124464 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
1183622136 22:38980728-38980750 CTGTGGGAGGCCGAGGTGGACGG - Intronic
1183729306 22:39608593-39608615 CTTTGGCAGGCCGAGGTGGATGG + Intronic
1184730640 22:46369340-46369362 CCCTGTCAGGGAGGGGTGGCTGG + Intronic
950581604 3:13865956-13865978 CCCTGTCAGGGAAGGGTGGAGGG + Intronic
952907595 3:38152558-38152580 CTTTGTGAGGCCGAGGTGGATGG - Intergenic
954312051 3:49777316-49777338 CCTTGGGAGGCCGAGGTGGATGG + Intronic
956517663 3:70067488-70067510 CCAAGTGGGGGCGAGGTGGAGGG - Intergenic
958736788 3:98018864-98018886 CTTTGGCAGGCCGAGGTGGACGG + Intronic
964284139 3:155099084-155099106 CCATGTTGGGGCAAGGTGGAGGG + Intronic
964654794 3:159054480-159054502 CAGTGTCAGGGAGAGAGGGAGGG - Intronic
966827474 3:183977225-183977247 CCATGTCAGGCCCAGGTGGAAGG + Intronic
968025359 3:195437958-195437980 CTTTGTGAGGTCGAGGTGGAAGG - Intronic
968042282 3:195598827-195598849 CCGTGTCAGAGAGAGGTGTGAGG - Intergenic
970981156 4:22098879-22098901 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
972782350 4:42297077-42297099 CTTTGTGAGGCCGAGGTGGAAGG + Intergenic
976883203 4:89955517-89955539 ACGTGGCTGGGGGAGGTGGAAGG + Intergenic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
980108636 4:128613140-128613162 CTGTGGGAGGCCGAGGTGGATGG + Intergenic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
987421925 5:17730398-17730420 CCATGGCAGGTCTAGGTGGAGGG - Intergenic
987510701 5:18834286-18834308 CTTTGGGAGGGCGAGGTGGATGG - Intergenic
988905508 5:35784416-35784438 CCGCGCCCGGGCGAGATGGATGG + Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
998981279 5:147705357-147705379 CCTTGGGAGGTCGAGGTGGATGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1002180139 5:177427010-177427032 TCGTGTCTGGGCGGGGTGTAAGG - Intronic
1004509096 6:16270186-16270208 CTGTGTCAAGGAGAGGTTGAAGG - Intronic
1005720201 6:28593961-28593983 CCTTGGGAGGCCGAGGTGGAAGG - Intronic
1007554279 6:42753168-42753190 CCTTGGGAGGGTGAGGTGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015828046 6:137336680-137336702 CCTTGGGAGGGCGAGGTGGGTGG - Intergenic
1019737977 7:2659824-2659846 CCGTGTGATGGCGAGGACGAGGG - Intronic
1020439520 7:8202269-8202291 ACATGTCAGGGCCAGGTGGAAGG - Intronic
1024370024 7:48571932-48571954 CTGTGGGAGGCCGAGGTGGATGG + Intronic
1024639474 7:51317167-51317189 CCGTGCGAGGGCGAGGTGGGCGG + Intergenic
1027178977 7:75924436-75924458 CTGTGGGAGGCCGAGGTGGACGG + Intronic
1029693845 7:102200582-102200604 CCGTGGGAGGCCGAGGTGGGAGG - Intronic
1029728339 7:102423355-102423377 CCCTGGGAGGCCGAGGTGGATGG - Intronic
1031244571 7:119292833-119292855 CATTGGCAGGCCGAGGTGGATGG + Intergenic
1032097385 7:128946360-128946382 CCAACACAGGGCGAGGTGGAGGG - Intronic
1032218456 7:129975783-129975805 CTGTGTGAGGCCGAGGTGGGTGG + Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034567413 7:151926475-151926497 CCCTGGCAGGGACAGGTGGAAGG - Intergenic
1036530372 8:9579710-9579732 CTGTGTGAGGCCGAGGTGGGCGG - Intronic
1037673311 8:21034092-21034114 CCGTGGGAGGCCGAGGTGGGTGG - Intergenic
1038333813 8:26630448-26630470 CAGAGTCCGGGAGAGGTGGAGGG + Intronic
1040015054 8:42692842-42692864 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1042770857 8:72380798-72380820 CAGTGACAGAGAGAGGTGGAGGG + Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1046106946 8:109677889-109677911 CTTTGGCAGGGCGAGGTGGGTGG + Intronic
1046129883 8:109954228-109954250 CAGTGGCAGGGTGAGGTGGGGGG + Intergenic
1047336025 8:123937148-123937170 CTCTGGGAGGGCGAGGTGGACGG - Intronic
1047384087 8:124393680-124393702 CCGTCTCAGGGTGGGGTGGGGGG - Intergenic
1048923555 8:139251531-139251553 CCTTCTCAGAGCAAGGTGGAGGG + Intergenic
1049812773 8:144582869-144582891 CCGTGGGAAGGCGAGGTGGTGGG + Intronic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1053168964 9:35864891-35864913 CAGTGGCAGGGCGAGGTGCGGGG - Intergenic
1053228219 9:36380735-36380757 CTGTGGGAGGCCGAGGTGGAAGG - Intronic
1053379284 9:37635944-37635966 CCATGTCAGGCGGAGGCGGAAGG - Intronic
1054778268 9:69141830-69141852 CTGTGGCAGGCCGAGGTGGGTGG - Intronic
1055567998 9:77588250-77588272 GGGTGTCAGGGTGTGGTGGATGG - Intronic
1056340876 9:85630721-85630743 CTTTGTCAGGCCAAGGTGGATGG - Intronic
1058592166 9:106576568-106576590 CCGTGGGAGGGCCAGGTGGCAGG + Intergenic
1060588163 9:124799631-124799653 CCCTGGCAGGGTGAGGTGCAGGG + Intronic
1060641975 9:125246472-125246494 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1060966374 9:127714472-127714494 CCGGGGCAGGGAGGGGTGGAAGG - Intronic
1061702283 9:132424857-132424879 CCGTGTTTGGGAGAGGAGGAGGG - Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062623305 9:137432169-137432191 CCGTGGGAGGCTGAGGTGGAAGG + Intronic
1062673565 9:137725825-137725847 GTGTGCCAGGGCGAGCTGGAAGG - Intronic
1203690612 Un_GL000214v1:38772-38794 CTGTGGGAGGCCGAGGTGGAAGG + Intergenic
1203645683 Un_KI270751v1:65419-65441 CTGTGGGAGGCCGAGGTGGAAGG - Intergenic
1185492634 X:529506-529528 CCTTGGGAGGGCGAGGTGGGTGG - Intergenic
1186660891 X:11666115-11666137 CCGGGACAGGGCGGGGTGGGGGG - Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187884511 X:23876555-23876577 CCTTGGGAGGCCGAGGTGGACGG + Intronic
1190057009 X:47186896-47186918 CCTTATCAGGCCAAGGTGGATGG + Intergenic
1191857179 X:65636491-65636513 CCTTGGGAGGCCGAGGTGGATGG + Intronic
1194318169 X:92408124-92408146 CTTTGTGAGGCCGAGGTGGATGG - Intronic
1198119701 X:133579777-133579799 CTGTGGGAGGGCGAGGTGGGAGG - Intronic
1198307045 X:135393685-135393707 CTTTGGCAGGGCGAGGTGGGCGG + Intergenic
1199165797 X:144673475-144673497 CCTTGTGAGTGAGAGGTGGAGGG - Intergenic
1200626339 Y:5521412-5521434 CTTTGTGAGGCCGAGGTGGATGG - Intronic