ID: 901330834

View in Genome Browser
Species Human (GRCh38)
Location 1:8407101-8407123
Sequence TAGGAAACCCTCTGTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901330827_901330834 19 Left 901330827 1:8407059-8407081 CCAGAAAGTGCTGTCTGCAGTGT 0: 1
1: 0
2: 0
3: 21
4: 246
Right 901330834 1:8407101-8407123 TAGGAAACCCTCTGTGGTACAGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901330834 Original CRISPR TAGGAAACCCTCTGTGGTAC AGG Intronic
900568171 1:3345663-3345685 CAGGACCCCCTCTGTGGTCCAGG + Intronic
901330834 1:8407101-8407123 TAGGAAACCCTCTGTGGTACAGG + Intronic
903005208 1:20293749-20293771 TATGAAACCCTCTGGGTTCCTGG + Intronic
905132813 1:35773986-35774008 TATGAAGCCCTCTATGGGACAGG - Intergenic
909849923 1:80448176-80448198 TATGAATTCCTTTGTGGTACTGG + Intergenic
910532432 1:88253365-88253387 TAGGAAACTTTCTGTGGTGATGG - Intergenic
910603855 1:89061283-89061305 TACAAAACCATGTGTGGTACTGG + Intronic
910636968 1:89419155-89419177 TACAAAACCATGTGTGGTACTGG - Intergenic
915576797 1:156784553-156784575 TAGGAACCACACTGAGGTACAGG - Intronic
919748228 1:201021734-201021756 AAGGAAACCCCCTGTGGAAAGGG + Intronic
921818143 1:219587041-219587063 TGGGAGACCCTTTGTGATACAGG - Intergenic
923101369 1:230820424-230820446 TAGGAGACCCTCAGTGGTAGTGG - Intergenic
923165157 1:231354508-231354530 TAGGAAGCCTTCTGTGGCAATGG - Exonic
1064396887 10:14989602-14989624 GTGGAAACCCCCTGCGGTACTGG - Intergenic
1067171596 10:43911433-43911455 CAGAAAACCCTCTGTGGTTCTGG + Intergenic
1068431022 10:56932430-56932452 TAATTAACCCTGTGTGGTACTGG - Intergenic
1070728541 10:78808885-78808907 AAGGAAGCCCCCTGTGGTATGGG - Intergenic
1076399709 10:130173850-130173872 AAGGAAACTGTCTATGGTACAGG - Intronic
1086324027 11:85680480-85680502 CAGGAGTCCCTCTGTGGGACTGG + Intronic
1087799873 11:102492177-102492199 TAGGTAAACCAATGTGGTACTGG + Intronic
1092644478 12:10554680-10554702 CAGGAAACCCTCTGGGGTCAAGG - Intergenic
1099038739 12:77623462-77623484 AAGGAAATTCTCTGTTGTACAGG - Intergenic
1101891220 12:108717318-108717340 TAGAAAGCCCTCTGTGATCCGGG - Intronic
1104745836 12:131209958-131209980 TGGGTAACACTTTGTGGTACAGG - Intergenic
1106827293 13:33537935-33537957 TAGGAACCCATCTGTGGCAAGGG + Intergenic
1108342425 13:49510950-49510972 GAGGAAACCCTTTGGGGTAATGG - Intronic
1108400483 13:50037194-50037216 TAGGAAACCCAGTGTAGAACTGG - Intergenic
1108511707 13:51162222-51162244 TTGGAAACACTTAGTGGTACAGG - Intergenic
1110452907 13:75656935-75656957 TAAGAAACATTCTGCGGTACCGG - Intronic
1113533194 13:111044722-111044744 TAGGGACCCCTCTGTGCTCCGGG + Intergenic
1115211082 14:30967809-30967831 TAGGAAACCTTCTGGGTTAAGGG - Intronic
1116142657 14:41018943-41018965 TAAGAAAGACTCTGTGGTACTGG - Intergenic
1116519154 14:45829725-45829747 TAGTACACCCTCTGTGATATTGG - Intergenic
1122499680 14:102188466-102188488 TTGCAGACCCTTTGTGGTACTGG + Intronic
1123214553 14:106794697-106794719 TACCAAACCCTCTGAGATACAGG - Intergenic
1123907267 15:24933303-24933325 TAGGAAAACATCTGTGGCTCTGG + Intronic
1124360017 15:29029816-29029838 TAGGCCACCCTCTGGAGTACAGG + Intronic
1127552264 15:60052234-60052256 TAAGAAAGCCTCTCTGGAACAGG + Intronic
1128942920 15:71802931-71802953 CAGGAAACCCCCGGTGCTACTGG - Intronic
1130613131 15:85379587-85379609 GAGGGAACCCTCTGGGGTGCTGG - Intergenic
1134747561 16:16599901-16599923 TAGGAAACCCTCAGTGGGCTGGG - Intergenic
1134997909 16:18753756-18753778 TAGGAAACCCTCAGTGGGCTGGG + Intergenic
1147866772 17:43558272-43558294 TATGAAATCCTCTGTGGATCTGG + Intronic
1149083999 17:52692557-52692579 TGGGGAACCCTCTGAGGAACTGG + Intergenic
1149678298 17:58486399-58486421 TAAGAAACCCTCTGTGATAGTGG - Intronic
1150986415 17:70202782-70202804 TAGGAAACCTTTTGTGGGAGAGG + Intergenic
1156768619 18:40690592-40690614 TAGGAAAGCTTCTGAGGTACAGG - Intergenic
1160121669 18:76135837-76135859 TGGGAAACCTTCTCTGGTATTGG - Intergenic
1167497388 19:49827657-49827679 TAGGTCACCTTCTGAGGTACTGG + Intronic
925567567 2:5272712-5272734 GAGGAACCCCTCTGTTGTAGTGG + Intergenic
929772028 2:44900449-44900471 TAGAAAACCCTGTGTGGTCAAGG + Intergenic
932350286 2:71025679-71025701 GTGTAAACCCCCTGTGGTACTGG + Intergenic
936094722 2:109523075-109523097 CAGGCAGCCCTCTGTGGTCCTGG + Intergenic
940874718 2:158887435-158887457 GTGTAAACCCCCTGTGGTACTGG + Intergenic
1171795766 20:29565849-29565871 TAGGAAAGACCCTGTGGTAGGGG + Intergenic
1171852463 20:30318293-30318315 TAGGAAAGGCCCTGTGGTAGGGG - Intergenic
1175793891 20:61759269-61759291 AATAAAACCCTCTGTGGTTCTGG + Intronic
1175811047 20:61857371-61857393 GTGGAAAACGTCTGTGGTACGGG - Intronic
1178627887 21:34233462-34233484 TAGGTCACACTCTGAGGTACTGG + Intergenic
1182268053 22:29134869-29134891 AAGGAGCCCCTCTGTGGCACAGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950040535 3:9916774-9916796 TCGGTAACCCTTTGTGGGACAGG - Intergenic
953292856 3:41683790-41683812 TAGGAAACTCTGTCTGGCACTGG + Intronic
962066530 3:131987270-131987292 AAGGAAAACCTCTTTGGTGCTGG + Intronic
963432255 3:145223286-145223308 TAGGGAACCATCTGTGGCAGTGG + Intergenic
965392857 3:168126974-168126996 TAGGAAAATCTCTGTGATATTGG + Intergenic
965744546 3:171910669-171910691 AAGGAAAAGCTGTGTGGTACTGG - Intronic
967599369 3:191366454-191366476 TAGGAAGTCTTCTGTGGAACAGG + Intronic
969734556 4:8978289-8978311 GTGGAAACCCCCTGCGGTACTGG + Intergenic
969785966 4:9457164-9457186 GTGGAAACCCCCTGCGGTACTGG + Intergenic
970994549 4:22250381-22250403 TTGGACAGCCTATGTGGTACTGG + Intergenic
972844838 4:42975042-42975064 TAGGAGTCCCACTGAGGTACAGG - Intronic
977972217 4:103225558-103225580 TAGGAAACCTTCTGAGTTAAGGG - Intergenic
980444060 4:132884211-132884233 TAGGAAATCTTCTGTGTTAAGGG - Intergenic
984791938 4:183623283-183623305 TAGAAAACACTCTGTGGGCCGGG + Intergenic
987846476 5:23293791-23293813 TATCAAAACCTCTGTGATACAGG - Intergenic
990732284 5:58822597-58822619 TCAGAAACACTCTGTGATACAGG + Intronic
992719643 5:79547863-79547885 GAGGACACCCTCAGTGGTGCTGG + Intergenic
993874178 5:93286684-93286706 TAGGAGACACTCTATGGCACAGG + Intergenic
995542937 5:113202045-113202067 GAGGAAAGCCTGTGTGGTAAAGG - Intronic
997517840 5:134503451-134503473 CAGGAAAACCTCTGTGGTCTGGG + Intergenic
997617184 5:135255545-135255567 TAGACAACTCTCTGTGGTGCAGG + Intronic
1001568601 5:172716038-172716060 TGGGAGGCCCTCTGTGGGACAGG - Intergenic
1005932809 6:30496491-30496513 CAGGAACCCCTATGTGGTAGTGG - Intergenic
1008187849 6:48416437-48416459 AAGGAAACCCTCTATACTACTGG - Intergenic
1015160636 6:130149092-130149114 TAGGAAAAGCCCTGTGGTATTGG - Intronic
1018687351 6:166314179-166314201 TAGGAAACCTTCTGGGTTAAGGG - Intergenic
1018828788 6:167425988-167426010 TAGGAAGCCCTCTGTGTGAGTGG + Intergenic
1020306688 7:6841146-6841168 GTGGAAACCCCCTGCGGTACTGG - Intergenic
1023110540 7:36806560-36806582 TAGGCAACCCTCTGGGATGCTGG + Intergenic
1023664696 7:42510626-42510648 GAGGAAACCTTCTGAGGTAGTGG + Intergenic
1023801790 7:43841306-43841328 TACAAAACCCTCTGTGTGACAGG + Intergenic
1026791462 7:73335204-73335226 GAGGAAACCCTCTGTGAAAGAGG - Intronic
1028259892 7:88650139-88650161 TAGTAAACCCTATGGGATACAGG + Intergenic
1031971021 7:128065305-128065327 TGGGAAACCCACTGTGGTTCAGG + Intronic
1032281462 7:130506018-130506040 TTGGAAAGCCTCTCTGGGACAGG - Exonic
1036819848 8:11931795-11931817 GTGGAAACCCCCTGCGGTACTGG - Intergenic
1036833023 8:12036746-12036768 GTGGAAACCCTCTGCGATACTGG - Intergenic
1041157998 8:55007503-55007525 AAGGCAACACTCTGAGGTACTGG + Intergenic
1045274870 8:100694693-100694715 AAGGGAGCCCTCTGAGGTACTGG + Intronic
1049525636 8:143125515-143125537 TAGGAAGCTCCCCGTGGTACAGG - Intergenic
1049699171 8:144000173-144000195 TAGGTCACACTCTGAGGTACTGG - Intronic
1050940083 9:11447743-11447765 TAGGAAGCTCTCTGTGGTAAAGG - Intergenic
1051744343 9:20280549-20280571 GAGGAAAACATCTCTGGTACTGG + Intergenic
1051885043 9:21883749-21883771 TAGGGAACCCTCTAGTGTACAGG + Intronic
1053790255 9:41681591-41681613 TAGGAAAGGCCCTGTGGTAGGGG - Intergenic
1054178601 9:61893292-61893314 TAGGAAAGGCCCTGTGGTAGGGG - Intergenic
1054474675 9:65564289-65564311 TAGGAAAGGCCCTGTGGTAGGGG + Intergenic
1054658932 9:67687537-67687559 TAGGAAAGGCCCTGTGGTAGGGG + Intergenic
1055723347 9:79200165-79200187 ACGGAAGCCCTCTATGGTACAGG - Intergenic
1058390729 9:104492295-104492317 TAGGTCACACTCTGAGGTACTGG - Intergenic
1060463523 9:123881697-123881719 TACAAAACACCCTGTGGTACAGG - Intronic
1195847082 X:109240377-109240399 TAGGAAACCTGCTGTGTTAAGGG + Intergenic
1196571420 X:117269558-117269580 TAACAAACCCTCTGAGCTACAGG + Intergenic