ID: 901336328

View in Genome Browser
Species Human (GRCh38)
Location 1:8452182-8452204
Sequence TGATCTCCCTGTCCAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901336323_901336328 -2 Left 901336323 1:8452161-8452183 CCTCCTCTACAGCACCCTTCCTG 0: 1
1: 1
2: 1
3: 37
4: 319
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139
901336320_901336328 25 Left 901336320 1:8452134-8452156 CCATCCTTCAAGGTCCTCTCAAA 0: 1
1: 1
2: 5
3: 20
4: 284
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139
901336321_901336328 21 Left 901336321 1:8452138-8452160 CCTTCAAGGTCCTCTCAAATAAG 0: 1
1: 0
2: 2
3: 14
4: 174
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139
901336322_901336328 11 Left 901336322 1:8452148-8452170 CCTCTCAAATAAGCCTCCTCTAC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139
901336324_901336328 -5 Left 901336324 1:8452164-8452186 CCTCTACAGCACCCTTCCTGATC 0: 1
1: 0
2: 3
3: 8
4: 149
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139
901336319_901336328 30 Left 901336319 1:8452129-8452151 CCTATCCATCCTTCAAGGTCCTC 0: 1
1: 1
2: 5
3: 45
4: 369
Right 901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG 0: 1
1: 1
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901336328 Original CRISPR TGATCTCCCTGTCCAAGAGC AGG Intronic
901263731 1:7893261-7893283 TGATCTACCTCTCAAAGTGCTGG - Intergenic
901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG + Intronic
903859115 1:26354526-26354548 TGCTCCCCATGTCCAGGAGCAGG + Intergenic
904887964 1:33755941-33755963 AGTTCTACCTGTCCAAGAGGTGG - Intronic
906153230 1:43599899-43599921 AGGTCTCCCTATCCAGGAGCAGG + Intronic
907911634 1:58832577-58832599 AGATCTCCCTGGCTAAGAGTGGG + Intergenic
910837446 1:91530031-91530053 TGATCTCTCTGTCCATTAGATGG + Intergenic
914513040 1:148351557-148351579 TGATGTCCCTGTCCAAGAGCAGG + Intergenic
914865911 1:151428435-151428457 TGAGCTCACTGACCAAGATCTGG - Intronic
915574510 1:156766893-156766915 TGATCTCCCTCACCAGGATCGGG - Intronic
923166328 1:231366977-231366999 TGGACTGCCTCTCCAAGAGCAGG - Intronic
924061969 1:240184672-240184694 TGATCAGTCTGTCCTAGAGCTGG + Intronic
1067080044 10:43207632-43207654 TGACCTCCCTGTCCTGGAGTGGG - Intronic
1069659059 10:70111617-70111639 TGCTCTCGCTGTCGAAGAGCAGG - Exonic
1069778641 10:70941324-70941346 GAACCTTCCTGTCCAAGAGCAGG + Intergenic
1070828532 10:79404980-79405002 TGGTCTCCCTGGCCCAGAGAGGG + Intronic
1073108753 10:101048285-101048307 TCATCTCCCTGCCCCGGAGCCGG - Intergenic
1074816878 10:117148908-117148930 TGATCTCCCTGGTCTAGAGCAGG + Intergenic
1076734303 10:132451922-132451944 GCATCTCCCTGTGGAAGAGCAGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078420302 11:11206340-11206362 TAATCTTAGTGTCCAAGAGCTGG + Intergenic
1078728090 11:13950141-13950163 TCCTCTCCCTGGCCAAGATCAGG + Intergenic
1081539763 11:44024232-44024254 GTATATCCCAGTCCAAGAGCAGG - Intergenic
1083228842 11:61302331-61302353 TGACCTCACTGTCAGAGAGCTGG - Exonic
1083358157 11:62083433-62083455 TGATCTGCCCGTCGAAGTGCTGG + Intergenic
1084968775 11:72758189-72758211 TGATCTCCCTGGGCAAGGACAGG - Intronic
1086899882 11:92354999-92355021 TGACCCCCCAGTCCAAGATCTGG - Exonic
1088039760 11:105364825-105364847 TGATCTCACTAGCCCAGAGCAGG - Intergenic
1091486675 12:895959-895981 TTATTTCCCTGTCAAAGAGTAGG - Intronic
1091942800 12:4504237-4504259 TGATCTACATGTCAAAGATCTGG + Intronic
1096303070 12:50448998-50449020 TGATCTGCCTGCCAAAGTGCTGG - Intronic
1096824703 12:54266156-54266178 TGATCTGCCTCTCAAAGTGCTGG - Intronic
1097684773 12:62681001-62681023 TCATCTCCCAATCCCAGAGCGGG - Intronic
1098700955 12:73625180-73625202 TGATCTCCATTTCCTAGAGAAGG - Intergenic
1101479526 12:105084016-105084038 TGAGATCCCTGGTCAAGAGCTGG - Intronic
1103863809 12:124035307-124035329 TGCTCTCCCTGTTCATGAGAAGG - Intronic
1107581185 13:41788648-41788670 TTATCTCCCAGTCCAATAGCTGG + Intronic
1109961332 13:69636571-69636593 TGAACCCCCTGTCAAAGTGCTGG + Intergenic
1113675631 13:112205055-112205077 AGCTCTCCCTGGCCAGGAGCGGG - Intergenic
1113928422 13:113953620-113953642 GGACCTCCCTGTCCTAGAGGTGG + Intergenic
1115798795 14:36969264-36969286 TGAGCTGCTTTTCCAAGAGCGGG + Intronic
1117082897 14:52169484-52169506 TGGTGTTACTGTCCAAGAGCAGG + Intergenic
1117333854 14:54739815-54739837 TGATCTCCGTGTCTAAGAGCAGG + Intronic
1119931108 14:78548374-78548396 TTATCTCCCTGTCCAAGTCATGG - Intronic
1124553048 15:30699894-30699916 TGTTCTCACTGTGCAAGAGTAGG - Intronic
1124678195 15:31705776-31705798 TGTTCTCACTGTGCAAGAGTAGG + Intronic
1125327717 15:38553790-38553812 TGAGATCCCTGCCTAAGAGCAGG - Intronic
1128154519 15:65384302-65384324 TGACCTCCATCTCCAAGACCTGG - Exonic
1131037938 15:89237154-89237176 TGGTGTTACTGTCCAAGAGCAGG - Intergenic
1133164894 16:3939308-3939330 TGATCTGCCTGCGCCAGAGCAGG - Intergenic
1133772295 16:8874285-8874307 TGATCTCCCTTCCGAATAGCTGG + Intergenic
1140896781 16:79331682-79331704 AGATCTTACTCTCCAAGAGCTGG - Intergenic
1141370166 16:83479415-83479437 TGATCTGCCCGTCAAAGTGCTGG - Intronic
1143474934 17:7197023-7197045 TGATCTCATTGTCCAGGTGCTGG + Exonic
1144108197 17:12005943-12005965 AGATCTCCCTGTTCTAGATCTGG + Intergenic
1144270186 17:13607814-13607836 TGATCTGCCTCCCCAAGCGCTGG - Intergenic
1145993131 17:29091086-29091108 TCATCTCCCTGGTCCAGAGCGGG - Intronic
1149141189 17:53435362-53435384 TGATCTGCCTCTCAAAGTGCTGG - Intergenic
1150281039 17:63929763-63929785 TGATCACCTTGTCCAGCAGCAGG + Exonic
1150307125 17:64095187-64095209 TGATCTGCCTCTCAAAGTGCTGG - Intronic
1151816443 17:76473682-76473704 TGATCTCGCAGTCCATGTGCAGG + Exonic
1152472585 17:80498715-80498737 TGCCCTCACTGGCCAAGAGCAGG + Intergenic
1153693614 18:7617869-7617891 AGATCTCCCAGACCAAGAGTAGG - Intronic
1158814950 18:61084461-61084483 TGATCTCCTGGGCCAAGAACAGG + Intergenic
1160923508 19:1531823-1531845 TGCGCCCCCCGTCCAAGAGCTGG - Exonic
1167670497 19:50850253-50850275 TGATGTCCCTGTCCTGGAGAGGG + Intergenic
1168194635 19:54765093-54765115 TGATCTCTCATTCCAAGATCTGG - Intronic
926352336 2:12007495-12007517 TGATCACACTGTCCTTGAGCTGG + Intergenic
928095966 2:28405159-28405181 TGATTTCCCTTTCCAAGACCAGG - Intronic
931423896 2:62153228-62153250 TGATCTGCCTCTCAAAGTGCCGG - Intergenic
931804826 2:65794150-65794172 TGATCTTCCTGTACCAGAGATGG - Intergenic
937555644 2:123152048-123152070 TTCACTCCCTGTCCCAGAGCAGG - Intergenic
939355055 2:141090668-141090690 TGATCTACATGTCCATGAGAAGG + Intronic
939538197 2:143459753-143459775 TAATCTACCTGTCCAACAGTGGG + Intronic
942246586 2:174013529-174013551 TTATTTCCCTGTCCTAGAGGAGG - Intergenic
942643237 2:178082966-178082988 TGATCCCCTTGGCCAAGAGATGG + Intronic
945933823 2:215883137-215883159 AGCTCTCCCTCTCCAAGTGCAGG - Intergenic
1171080222 20:22174113-22174135 TGCTCTACCCGTCCATGAGCAGG + Intergenic
1171494809 20:25548395-25548417 AGAACACCCTGTCCAAGACCAGG - Intronic
1174282977 20:49452688-49452710 TGACCTCCATGCCCAAGGGCTGG - Intronic
1174347965 20:49945380-49945402 AGTTCTTCCTGTCCAAGATCCGG + Exonic
1176215219 20:63944716-63944738 AGATCTTCATGTCCAGGAGCTGG + Exonic
1180142124 21:45899044-45899066 GTATCTCCCTGTCCAGCAGCGGG - Intronic
1182619629 22:31611762-31611784 TGCTCTGCCTGTGCAGGAGCTGG - Exonic
1184936443 22:47727079-47727101 TAATCTCCTTGGCCAAGAGGGGG - Intergenic
954362676 3:50130521-50130543 CAATCTCCCTCTCCCAGAGCTGG + Intergenic
954410338 3:50367858-50367880 TGATGCCCGTGTCCAAGATCAGG + Exonic
954697319 3:52434791-52434813 GGCTCTCCATGTCCACGAGCGGG - Exonic
955756877 3:62233698-62233720 TCATCTCCCTGTCCCACAGCAGG + Intronic
959289341 3:104452900-104452922 TGATCTGCCTGCCAAAGTGCTGG - Intergenic
960673146 3:120171126-120171148 TGACTTCCCTGTCTAAGAGAAGG - Intronic
962248496 3:133819375-133819397 TCACCTCTCTGTCCAAGAGAGGG + Intronic
962362262 3:134752396-134752418 TGACCTCCCTGTCAAGGAGAGGG + Intronic
963065123 3:141257660-141257682 TGATCTGCCTGCCAAAGTGCTGG - Intronic
968625032 4:1623183-1623205 TGATGTCCCCGTCCTGGAGCGGG - Intronic
971521546 4:27558034-27558056 TTATCTCCCTGTGCCAGGGCTGG + Intergenic
972942116 4:44208614-44208636 TGATCTTCTTGTCCAGGAGTTGG + Intronic
973590333 4:52434401-52434423 TGACCTCCCTGGCCTGGAGCTGG + Intergenic
974814881 4:66991065-66991087 TGATCTACCTGCCAAAGTGCTGG + Intergenic
975292607 4:72694779-72694801 TGATTGCCCTGCCCAGGAGCTGG + Intergenic
980020439 4:127703144-127703166 TGAACTGCCTGTACAATAGCAGG - Intronic
982513490 4:156315169-156315191 TGATCTCCTTGTAAAAGAGAAGG + Intergenic
984733588 4:183090213-183090235 TGATTTCCCTATTCCAGAGCTGG - Intergenic
985124724 4:186682111-186682133 TGATCTCCTTATCTAACAGCTGG + Intronic
992873382 5:81028053-81028075 TGATCTGCCAGTCAAAGAGCTGG + Intronic
994012951 5:94928878-94928900 GGATCTCCCTGTCCTCAAGCTGG + Intronic
996376488 5:122814009-122814031 TGATCTGCCTGCCAAAGTGCAGG + Intronic
998366835 5:141637483-141637505 CGATCTCCCTGACCCAGGGCCGG + Exonic
998534158 5:142913988-142914010 TGAGCTGCCTGTTCAAGATCAGG + Intronic
1000883269 5:166721260-166721282 TGATATGCCTGCCCAAGAGTTGG - Intergenic
1001581975 5:172805137-172805159 TGATGTAGCTGTCCAAGAGATGG + Intergenic
1007637561 6:43308378-43308400 TGAGCTCCCTGGGCAAGAACTGG - Exonic
1007749128 6:44061241-44061263 TGTTCTGCCTGGGCAAGAGCAGG + Intergenic
1018971512 6:168532588-168532610 TGTGCACCCTGACCAAGAGCTGG + Intronic
1021800868 7:24305216-24305238 TTAAGTACCTGTCCAAGAGCAGG + Intergenic
1021845649 7:24759818-24759840 TGCTCTCCCTGTCCAATGGTGGG + Intergenic
1022833147 7:34088316-34088338 TGATCTCACAGTCCAACAGGAGG + Intronic
1024143436 7:46485376-46485398 TGATCTACCTGTCAAGGAGGAGG - Intergenic
1024145648 7:46513894-46513916 TTAGCTCCTTGTTCAAGAGCTGG - Intergenic
1026211213 7:68307095-68307117 GAATGCCCCTGTCCAAGAGCTGG - Intergenic
1026523086 7:71132867-71132889 TGCTCTTCCTGGCCAAGTGCCGG + Exonic
1029712798 7:102308704-102308726 TGATCCCCCTCTCCCACAGCAGG - Intronic
1030680525 7:112429036-112429058 TGACCTGTCTGTCCAAAAGCAGG + Intronic
1032686323 7:134237627-134237649 TGCTTTCCCTGTCCCAGACCTGG + Intronic
1034580901 7:152041541-152041563 TGGTGTTACTGTCCAAGAGCTGG - Intronic
1035788788 8:2284868-2284890 AGATCCCCTTGGCCAAGAGCAGG - Intergenic
1035804017 8:2436837-2436859 AGATCCCCTTGGCCAAGAGCAGG + Intergenic
1036726062 8:11222234-11222256 CGATCTTCCTGTCAAAGTGCTGG + Intergenic
1037286045 8:17301679-17301701 TAACCTCCCTGTCCAAGTACAGG + Intronic
1041446427 8:57955743-57955765 TTCTCTCCCTGTCCATGAGGTGG - Intergenic
1042797775 8:72683606-72683628 TGCTCTCCCTGACCAAGTGATGG - Intronic
1047345023 8:124019485-124019507 TCTTCTCCCTGTCCCAGACCTGG + Intronic
1048973456 8:139657916-139657938 GATTCTCCCTGTCCAACAGCAGG + Intronic
1050751930 9:8948982-8949004 TGATCTGCCTGCCAAAGTGCTGG - Intronic
1053515348 9:38725863-38725885 TGATCTGCCTGCCAAAGTGCTGG + Intergenic
1054880701 9:70141913-70141935 TGTTCTCCCTGTCCCAGAAAGGG - Intronic
1055495786 9:76853570-76853592 TGATCTCGCTGTACAAAATCAGG + Intronic
1056856291 9:90132317-90132339 AGATCTCCATCTCCAAGGGCTGG - Intergenic
1057301469 9:93887768-93887790 TGATCTGCCTGCCAAAGTGCTGG - Intergenic
1058127794 9:101215516-101215538 TGATCCCCCTGCCTAAGTGCAGG + Intronic
1061344217 9:130009247-130009269 TGATGTCCCTTTCTAAGAGAAGG + Intronic
1203566176 Un_KI270744v1:91780-91802 TGATGTCCCAGTCGAAGTGCAGG - Intergenic
1191698278 X:64012516-64012538 TATTCTTCCTGTCCATGAGCAGG - Intergenic
1195702440 X:107715613-107715635 TGAGCTCCCTGCCCAACAACAGG + Intronic
1198068555 X:133124796-133124818 TGATTTTCCTATCCATGAGCAGG + Intergenic
1201078504 Y:10208286-10208308 TCTTCTCCCTGTCAAAGACCAGG - Intergenic
1201851682 Y:18489926-18489948 TGCTCATCCTGTTCAAGAGCAGG - Intergenic
1201881638 Y:18830454-18830476 TGCTCATCCTGTTCAAGAGCAGG + Intergenic