ID: 901347345

View in Genome Browser
Species Human (GRCh38)
Location 1:8557602-8557624
Sequence TACGTGTCCACCCGTTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901347345_901347349 5 Left 901347345 1:8557602-8557624 CCCTGTAAACGGGTGGACACGTA 0: 1
1: 0
2: 0
3: 1
4: 17
Right 901347349 1:8557630-8557652 GGAGAGACACAATTACCATCAGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901347345 Original CRISPR TACGTGTCCACCCGTTTACA GGG (reversed) Intronic
901347345 1:8557602-8557624 TACGTGTCCACCCGTTTACAGGG - Intronic
908139638 1:61170771-61170793 TAAGTGTCCAGCCGTTAAAAAGG - Intronic
923937929 1:238784978-238785000 TACTTTTCTACCCGTTTACAGGG - Intergenic
1064363335 10:14685478-14685500 TAGGTGTCCCCCAGTTTTCAAGG + Intronic
1067522799 10:47020832-47020854 TACATGTCACCCCATTTACAAGG + Intergenic
1093705456 12:22269964-22269986 TAAGTCTCCATCCGTTTCCAAGG + Intronic
1101805773 12:108062355-108062377 TTCTGGTCCACCCTTTTACAAGG + Intergenic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1147591956 17:41689375-41689397 TACGTCACCACCCGTTGTCACGG + Intronic
1162068769 19:8141492-8141514 TACGTGTGCACCTGTTCCCAAGG - Intronic
1182969778 22:34562964-34562986 TACGTGTGCAGACTTTTACATGG + Intergenic
1185242865 22:49755773-49755795 TACGGTGCCACCCCTTTACATGG + Intergenic
965648921 3:170913189-170913211 TTCCTGTCCACCCCTTGACAAGG + Intergenic
1026127504 7:67592212-67592234 TACGTGTACACCCATGTTCATGG - Intergenic
1027252836 7:76409817-76409839 TAGGTCTCCACCCCTTTGCAGGG + Intronic
1028420178 7:90624069-90624091 TACATGTCCACTCCTTCACAGGG - Intronic
1045179819 8:99768371-99768393 TATGTGTACACGCTTTTACAAGG + Intronic
1047645892 8:126869268-126869290 TATGTGAACACCCGTTTAAAAGG + Intergenic
1187961818 X:24573536-24573558 TAGGTGTTCATTCGTTTACAGGG - Intronic