ID: 901347638

View in Genome Browser
Species Human (GRCh38)
Location 1:8560481-8560503
Sequence ATGGCCTACTGGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901347633_901347638 6 Left 901347633 1:8560452-8560474 CCTGGTTCGAGCACTACAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG 0: 1
1: 0
2: 2
3: 16
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901347638 Original CRISPR ATGGCCTACTGGAAAGAAGA TGG Intronic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
902800962 1:18829821-18829843 ATGGTTTACAGGAAAAAAGATGG - Intergenic
903452808 1:23466076-23466098 ATGTCCTACTGAAAAGAAAACGG + Intronic
903768734 1:25750853-25750875 ATGGCCTGCAGGAAGGAAGAGGG + Intronic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
905521939 1:38607302-38607324 TTGGCAAACTGGAAAGAAAATGG + Intergenic
907588390 1:55642270-55642292 ATTGCATAAGGGAAAGAAGATGG - Intergenic
907594823 1:55710019-55710041 ATTTCCTACTGGAAAGATGAAGG + Intergenic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
911093353 1:94035619-94035641 ATGCCACACTGGAAAGAAGGAGG + Intronic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
913016016 1:114736054-114736076 CTGGCCTACTGGGCAGATGATGG - Intronic
914235001 1:145801239-145801261 ATGGTATAATGAAAAGAAGATGG - Intronic
914900357 1:151708173-151708195 AAAGCCTACTGGAATGAAAAGGG + Intronic
915572971 1:156755380-156755402 GTGGTCTAGTGGAAAGAAGCTGG + Intronic
915969145 1:160340742-160340764 AAGGACCACTGGAAAGGAGAAGG - Intronic
916593717 1:166221020-166221042 AGGGCCTACTTGAAGGCAGAAGG - Intergenic
918322167 1:183374743-183374765 ATGGCTTCCTAGAGAGAAGATGG - Intronic
918338318 1:183544475-183544497 CTGGCCTGCTGGGAAGAGGAGGG - Exonic
918456558 1:184725225-184725247 ATAGCCCACTGGAAAGAGTATGG + Intronic
920316161 1:205076972-205076994 AGGGCCTCCTGGAATGAGGAAGG - Exonic
920955988 1:210620473-210620495 ATGGGCTACAGGAAAGGAAAAGG - Intronic
921188963 1:212693199-212693221 ATGCCCTCCTGGAAGGAACAGGG + Intronic
923265322 1:232308219-232308241 AGGGCTTACTGAAAAGAACAGGG + Intergenic
924797016 1:247300034-247300056 TTGGACTAGAGGAAAGAAGAAGG - Exonic
1063517272 10:6709455-6709477 AGAGCCTACTGGAAGCAAGAGGG + Intergenic
1065179142 10:23107368-23107390 AAGGCCCACATGAAAGAAGAGGG - Intronic
1065793568 10:29284060-29284082 ATGGCCCCCAGGTAAGAAGATGG + Intergenic
1067410889 10:46063633-46063655 TTGGCCTGATGGAGAGAAGAAGG + Intergenic
1067921934 10:50467971-50467993 ATGGACTTCTGGGAATAAGATGG + Intronic
1074313781 10:112344182-112344204 GTGGCATGCTGGAAAGAACATGG - Intergenic
1075607564 10:123824621-123824643 ATGGCATCCTGGAAAGATCAGGG + Intronic
1076632407 10:131858948-131858970 TTGGCCTACTTTAAAGAAAAGGG - Intergenic
1077955159 11:7010408-7010430 AGGGCCTACTTGAAGGTAGAGGG + Intronic
1078825044 11:14921668-14921690 ATAGTATACTGGAAAGAAAAAGG + Intronic
1079728447 11:23907602-23907624 ATGGCCTACTTGAGGGCAGAGGG + Intergenic
1080638414 11:34143399-34143421 AAAGCCTGCTAGAAAGAAGAGGG - Intronic
1080959564 11:37142514-37142536 AAGAACTACTGGAAAGGAGAAGG - Intergenic
1082116070 11:48329560-48329582 AAGGCCTACTAGAAGGTAGAGGG + Intergenic
1084584189 11:70046763-70046785 ATGGGATCCTGGAAAGAAAAAGG + Intergenic
1086947081 11:92853959-92853981 ATGGGCTCCTGGACAGAAAAGGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087258586 11:95984742-95984764 ATGGCTTCCTGGACAGATGAAGG + Intronic
1088622721 11:111703080-111703102 ATCCTCTACTGGAAAGCAGAAGG - Intronic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089466548 11:118689775-118689797 ATGTCATACTGGGAATAAGAGGG + Intergenic
1089969636 11:122682474-122682496 AAGGCAGACTGGAAAGAATATGG - Intronic
1090158606 11:124467687-124467709 ATGGGCTATTGGAAAGAACTAGG - Intergenic
1091010706 11:131998045-131998067 AAGGCCTCCAGGAAAGAGGAGGG - Intronic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1092445208 12:8549457-8549479 GTGGCCGACTGTCAAGAAGAAGG + Intergenic
1094693212 12:32790168-32790190 ATGGTCTTCTGGAATGAAGGGGG - Intergenic
1095862182 12:46929870-46929892 ATGGCGAACAGTAAAGAAGATGG - Intergenic
1096042979 12:48536226-48536248 AGGGCCTACTTGAGAGCAGAGGG + Intergenic
1096254784 12:50056393-50056415 ATGGCACATTGGAAAGAAGTTGG - Intergenic
1096960665 12:55573844-55573866 AGGGTCCACTGGAAAGAAGTGGG + Intergenic
1097376061 12:58844399-58844421 AAGACCTACTGGAGTGAAGAGGG + Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1100242803 12:92726744-92726766 ATGGGCCAAGGGAAAGAAGAAGG + Intronic
1100845082 12:98649978-98650000 AGGGCATACTGGGTAGAAGAGGG + Intronic
1102050903 12:109861285-109861307 ATAGCCCAATGGAAAGAAGGTGG + Intronic
1103148915 12:118619966-118619988 ATGGTGAACTGAAAAGAAGATGG - Intergenic
1104535502 12:129614363-129614385 ATGCCCTGCTGCAAAGAGGACGG + Intronic
1105774124 13:23640595-23640617 AAGGCCTACTTGAGAGGAGAAGG - Intronic
1106256314 13:28025372-28025394 AAGGCAAACTGGAAAAAAGAAGG - Intronic
1107212443 13:37873594-37873616 ATTTCCTACTTGAAAGAAAATGG + Intergenic
1107691668 13:42959692-42959714 ATGGCTTACTGGAAAGAGCAAGG + Intronic
1108597419 13:51961379-51961401 ATGGCTGAGTGGAAAGAAAATGG - Intronic
1109058792 13:57586055-57586077 AGGTACTACTGGAGAGAAGAGGG + Intergenic
1109714175 13:66199547-66199569 AAGGCCTACTTGAGAGTAGAAGG + Intergenic
1109999418 13:70175482-70175504 ATGGCCTATGGAAAAAAAGATGG + Intergenic
1111012535 13:82330096-82330118 ATGGACTCCTGGAAAGCTGAGGG + Intergenic
1113932146 13:113974202-113974224 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1113932160 13:113974249-113974271 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1113932174 13:113974296-113974318 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1113932188 13:113974343-113974365 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1113932202 13:113974390-113974412 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1113932216 13:113974437-113974459 CCGGCCTGCGGGAAAGAAGAAGG - Intergenic
1115698511 14:35925337-35925359 ATGTCCTAAAGGACAGAAGATGG - Intronic
1116123103 14:40746344-40746366 ATGGCCTGCTTTAAAGGAGAAGG - Intergenic
1116423140 14:44756882-44756904 ATGCCATTCTGGAAAGAAGTAGG + Intergenic
1116510000 14:45733327-45733349 ATGGCTGACTAGAAATAAGAAGG + Intergenic
1116578615 14:46608789-46608811 AGGGCCTACTTGAAGGTAGAGGG - Intergenic
1116809519 14:49525717-49525739 TTTGCCTAATGGAATGAAGAAGG + Intergenic
1118840368 14:69505442-69505464 ATGGCCTAGTGATAAGATGAAGG + Intronic
1119065487 14:71521533-71521555 ATGGCCTACTTCATAGTAGAAGG + Intronic
1119332833 14:73808044-73808066 ATTGGCTGCTGGAAAGGAGAAGG + Intergenic
1119371210 14:74145412-74145434 CTGGCATACTGTAAGGAAGAAGG - Intronic
1120116001 14:80618405-80618427 AAGGCCTTCTGGCAAGAAGATGG + Intronic
1122002454 14:98671149-98671171 ATAGACTACTAGAATGAAGATGG - Intergenic
1123921464 15:25072746-25072768 CAGGCCTGCTGGAAGGAAGATGG + Intergenic
1124412800 15:29450940-29450962 GGGGCCTACTTGAGAGAAGAGGG + Intronic
1125090401 15:35784264-35784286 AATGCCTAGTGGAAAGAGGATGG - Intergenic
1125546965 15:40512889-40512911 CAGGCCTGCTGGACAGAAGAGGG - Intergenic
1125885664 15:43227428-43227450 ATGGCCCACGTGAAAGATGATGG + Intergenic
1126010700 15:44299600-44299622 ATGGTTCACTGGAAAGAACAAGG + Intronic
1127478929 15:59360481-59360503 ATGGCCTGCTGGACAGAAAGGGG - Intronic
1128691198 15:69726131-69726153 ATGACCTTATGGGAAGAAGATGG + Intergenic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1129219339 15:74122354-74122376 ATTGCCTACAGGCAAGGAGAGGG + Intronic
1130558721 15:84942690-84942712 ATGGCCCACAGGAAAGAGTAAGG - Intronic
1130960738 15:88657217-88657239 ATGGCCCACTGCACAGATGAGGG + Intergenic
1131129618 15:89888713-89888735 AGGACCCACTGGAAAGGAGAAGG + Intronic
1131955978 15:97736684-97736706 ATGTCCTATTGTAAAAAAGAGGG + Intergenic
1134284404 16:12847860-12847882 ATGATCTACTTCAAAGAAGAAGG - Intergenic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1142141102 16:88473252-88473274 ATGGCCCACTTGGAAGAGGATGG + Intronic
1142754343 17:2006978-2007000 ATGGGGTCCTGGAAAGATGAAGG + Intronic
1143250804 17:5521735-5521757 ATGGCCCACTTTAAAGAGGAGGG - Exonic
1144016888 17:11204624-11204646 AGGGCCTATAGGAAAGCAGAAGG + Intergenic
1144405356 17:14947799-14947821 AGGGCCTGGTGGAGAGAAGAAGG - Intergenic
1145001740 17:19310053-19310075 GTGGCTCACTGGGAAGAAGATGG + Intronic
1148068593 17:44892474-44892496 ATGTCCTAGTGAAAAGAACATGG - Intronic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1149957643 17:61070254-61070276 TTGGCCTGATGGAGAGAAGAAGG + Intronic
1150297031 17:64016594-64016616 ATTGCCCACTGGCAAGAAGGAGG - Intronic
1155783141 18:29864600-29864622 ATGGCATGCTAGAAAGAACATGG - Intergenic
1156591752 18:38497561-38497583 AAGGGTTACTGGCAAGAAGAAGG + Intergenic
1157729877 18:49994192-49994214 ATGGGCTAAGGGGAAGAAGAGGG - Intronic
1157829298 18:50841762-50841784 ATGGTATAGTGGAAAGAATATGG + Intergenic
1158264885 18:55651058-55651080 TTGACATACTGGAAAGAATAAGG + Intronic
1159557263 18:69958376-69958398 ATGGCAGATTGGAAACAAGATGG - Intronic
1161063650 19:2227348-2227370 GTGGCCTTCTGAAAACAAGAGGG - Intronic
1164650671 19:29888851-29888873 TTAGCCAACTGGAAAGAAAATGG - Intergenic
1166025519 19:40080663-40080685 AGGGCCTACTTGAGAGTAGAGGG + Intronic
1168374517 19:55865140-55865162 AGGGCCTACTTGAGAGCAGAGGG - Intronic
926578816 2:14612463-14612485 ATGGCATGCAGGAGAGAAGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927089614 2:19700615-19700637 AAGGGCTACTGGGAACAAGAAGG - Intergenic
927226153 2:20767603-20767625 ATGGGCCACTGGGCAGAAGAGGG + Intronic
928078217 2:28285077-28285099 ATGGCATACTGGGAAGAAAACGG - Intronic
928082045 2:28320263-28320285 AGAGCCTACTGGGAACAAGAAGG + Intronic
929245571 2:39698657-39698679 ATGGCCTCATAGAAAGAAGTAGG + Intronic
933123191 2:78568920-78568942 ATGCACAACTGGAAAGAATAGGG - Intergenic
933279821 2:80321234-80321256 AAGGCCTCCTGGAAAAAAAAAGG + Intronic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
938203502 2:129397443-129397465 ATGGCTTTCTTGAAGGAAGAGGG + Intergenic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
939021355 2:136961623-136961645 ATGTCCAACTGGAAACAAGGAGG + Intronic
939513578 2:143138358-143138380 ATGGCATACTGAAAATAACATGG - Intronic
940458251 2:153929501-153929523 ATGGCCTACTTGAAGGTGGAGGG - Intronic
940965786 2:159836087-159836109 CTGGCATAGTGGAAAGAATATGG + Intronic
941147847 2:161874709-161874731 ATGGCACACTGGAAAGAATGTGG + Intronic
941239957 2:163024994-163025016 AGGGCCTACTGGAGGGCAGAGGG + Intergenic
943053543 2:182946427-182946449 AGGGCCTACTTGAAGGTAGAGGG + Intronic
944858565 2:203792194-203792216 AGGGCATGCTGGAAAGATGATGG + Intergenic
946347829 2:219125488-219125510 GTGGCCGGCTGGAAAGAGGAGGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
1169764471 20:9133969-9133991 ATGTCCTACTGTAAAGACCAGGG + Intronic
1169951769 20:11052448-11052470 ATGCCCTACTGAAAAGGAGTGGG + Intergenic
1170305659 20:14934979-14935001 TTGGCCTACTGGATACCAGAGGG + Intronic
1170953985 20:20961808-20961830 ATTGCCTACTGGGAAAAAGGGGG + Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1174027732 20:47592646-47592668 ATGGCATTATGGAAAGAAAATGG - Intronic
1174045657 20:47730828-47730850 AAGGGCTGCTGGAAAGAATAAGG - Intronic
1174046890 20:47740185-47740207 ATGGCCCATTTGACAGAAGAGGG + Intronic
1175578682 20:60081875-60081897 AGGGCCCACTGGAAAGACGATGG + Intergenic
1175870980 20:62209337-62209359 ATGGGCTTTAGGAAAGAAGATGG + Intergenic
1175873082 20:62217493-62217515 AGGGCCTCTTGGGAAGAAGAGGG + Intronic
1178090180 21:29154347-29154369 TTGGCTTAATGAAAAGAAGAGGG - Intronic
1178935914 21:36861546-36861568 GTGGCCTACTGGAGGGTAGAGGG - Intronic
1179191733 21:39127953-39127975 TTGGCCTGATGGAGAGAAGAAGG + Intergenic
1179875895 21:44267278-44267300 ACGGGCTCCTGGAGAGAAGATGG - Intergenic
1181141072 22:20805305-20805327 AATGCCCACTGGAAAGAAGTTGG + Intronic
1181873665 22:25923152-25923174 ATGTGCTATTGGAAAGAATATGG + Intronic
1182509035 22:30806004-30806026 AGGGCATACAGGACAGAAGAAGG - Intronic
1184640166 22:45866475-45866497 ATGGCCTACGGGAAGGGAGCTGG - Intergenic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
1185120950 22:48969703-48969725 ATGGCCTAAAGGACAGGAGACGG - Intergenic
950218302 3:11175361-11175383 ATGGCCTAATGGTCAGGAGATGG - Intronic
950714956 3:14841514-14841536 ATGGATTACTGGAGAGAGGAAGG + Intronic
952590418 3:34946433-34946455 ATGACCTAGTGGAAAGAACAAGG + Intergenic
953243197 3:41167698-41167720 AGTGCCTAGTGAAAAGAAGAGGG + Intergenic
953576180 3:44114737-44114759 GTGGCCTCCTGGAGAGAGGAAGG + Intergenic
954798558 3:53173985-53174007 ATGGCATACTGGAAAGGACCTGG + Intronic
956104544 3:65803701-65803723 GGGGCCTACTGGAAGGTAGAGGG - Intronic
958747178 3:98151110-98151132 ATGGCATAGTGGGAAGAAAATGG + Intergenic
959457466 3:106580579-106580601 ATGGCCTGTGGGAAAGATGATGG + Intergenic
960601222 3:119460351-119460373 ATGGTATACTGGGAAGAAGTAGG - Intronic
961910635 3:130312723-130312745 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
962702850 3:138016202-138016224 AAGGCCTCGTGGATAGAAGATGG + Intronic
963033178 3:140999543-140999565 ATGGCCAGCAGGCAAGAAGAGGG - Intergenic
963622490 3:147629091-147629113 ATGGCCTTCTAGATGGAAGAGGG - Intergenic
964288115 3:155143425-155143447 AGGGCCTACGGAAAAGAAAAAGG - Exonic
964887928 3:161505605-161505627 ATGAACTACTGGAAAAAAGTGGG + Intergenic
965036716 3:163449335-163449357 AGGGCCTACTTGAAAGTGGAGGG + Intergenic
965133961 3:164738615-164738637 ATGCTATACTGGAAAGAGGAAGG - Intergenic
965352686 3:167633863-167633885 GTTGCCTAATGTAAAGAAGATGG - Intronic
965921169 3:173915774-173915796 ATGGTTTTCTGGAAAGAAAAAGG - Intronic
966540693 3:181086711-181086733 ATAGCGTACTTGAAAGAAGCTGG + Intergenic
967286702 3:187878379-187878401 ATGCCCTACAGGATAGGAGAGGG - Intergenic
967597832 3:191348623-191348645 ATGGCATATTGGAAAGAACAGGG + Intronic
970267730 4:14307518-14307540 AAGGCCAACTGGAACAAAGAGGG - Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
976078789 4:81330803-81330825 ATGGCATAGTGGAGAGAAGGTGG + Intergenic
977561779 4:98540291-98540313 ATGACCTCTTGGGAAGAAGATGG + Intronic
978252987 4:106655606-106655628 AGGGCCTACTTGAGAGTAGAGGG + Intergenic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
981103890 4:140858833-140858855 CTGGTCTAGTGGAAAGATGATGG + Intergenic
983508409 4:168580959-168580981 GGGGCCTACTGGAGGGAAGAAGG + Intronic
985014607 4:185620147-185620169 ACGGTCTATTGGAAAGAACAGGG + Exonic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
988294692 5:29341018-29341040 ATGGCCTTCAAGAAAGATGATGG - Intergenic
988789365 5:34593142-34593164 ATGGCCTTGTGGTAGGAAGATGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
991164230 5:63543638-63543660 ATGGCAGACTGGGAAGAAAATGG - Intergenic
992380269 5:76229440-76229462 AAGTCCAAATGGAAAGAAGAGGG - Intronic
993223946 5:85141108-85141130 AGAGCCTACTGGTAATAAGAAGG - Intergenic
994645705 5:102466181-102466203 GTGGCCTACTGGAGGGCAGAGGG - Intronic
995727100 5:115192756-115192778 ATGGGATCCTGGAAAGAAAAAGG - Intergenic
995795915 5:115941166-115941188 ATGTCCTACTGACAGGAAGAGGG - Intergenic
996442872 5:123512038-123512060 ATCGCCGACCGGAAAGGAGACGG - Intergenic
1003094341 6:3130937-3130959 ATGGCCTACTGTGCACAAGATGG - Intronic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1004970114 6:20900523-20900545 ATGGGCTACTTGAGAGAAAAAGG + Intronic
1008784270 6:55146480-55146502 ATGCCTTATTGGAAAGAAGTTGG + Intronic
1011228429 6:85133591-85133613 ATGGGCTAATAGAAAAAAGAAGG + Intergenic
1012145393 6:95673965-95673987 AGGGCATACTGGGAAGAGGAGGG - Intergenic
1012359302 6:98357248-98357270 ATGGCCTGTTTGAAAGAAAATGG - Intergenic
1014719688 6:124901025-124901047 ATGAGCAAATGGAAAGAAGATGG - Intergenic
1015111486 6:129596780-129596802 ATGGCTTACAGCAAAGTAGATGG + Intronic
1015212602 6:130715196-130715218 CTGGCCTCCTGAAAAGAAGGTGG + Intergenic
1015232572 6:130933094-130933116 ATGGCCTACTCTTAAGAGGAAGG - Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1017875711 6:158522685-158522707 ATGGCCTGGTGGAAAGGAAATGG + Intergenic
1018349406 6:162941221-162941243 TGGGACTACTGGAGAGAAGAAGG - Intronic
1018599595 6:165525411-165525433 ATGGCCTACTATGAGGAAGATGG + Intronic
1018830724 6:167441306-167441328 ATGACCTGCTGTAAAGAACAAGG + Intergenic
1019102342 6:169641420-169641442 CTGGCCAACTGAAAAGAGGAGGG - Intronic
1021185213 7:17556104-17556126 ATGGCCTAATGGAAAGTAAGAGG - Intergenic
1023457147 7:40352464-40352486 AGGGCCTACTTGAGAGTAGAGGG - Intronic
1023528912 7:41133560-41133582 ATGGCCAAGTGCACAGAAGAAGG + Intergenic
1023763570 7:43489597-43489619 ATGGCCTACTTGAAGGACAAGGG - Intronic
1024696015 7:51857403-51857425 AAGGCCTACAGTAAAGAAGCTGG + Intergenic
1027133846 7:75610613-75610635 TGGGCCTACAGGAAAGGAGAAGG - Intronic
1027525057 7:79258425-79258447 ATGGCCTGGTTGAAGGAAGAAGG - Intronic
1027560633 7:79724492-79724514 ATGGCCTACTTCAAAGAAGAAGG + Intergenic
1030065284 7:105654725-105654747 ATGGCCTGAAGGAAAGAAGAGGG - Intronic
1031474720 7:122207446-122207468 ATGGCCTACTGTAAGCAAGCTGG - Intergenic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1039777253 8:40749245-40749267 CTGGTCCACTGGAAAGGAGAAGG + Intronic
1040724451 8:50364691-50364713 AAGGCCTATAGGAAAGCAGATGG - Intronic
1042143030 8:65698691-65698713 AGGGCCTACTTGAGAGTAGAAGG - Intronic
1042751664 8:72164088-72164110 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1042764228 8:72302852-72302874 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1043355830 8:79411512-79411534 AGGGCCTACTGGAGAGTGGAGGG + Intergenic
1043482848 8:80670315-80670337 ATGGCACAGTGGAAAGAACAAGG - Intronic
1044357160 8:91235805-91235827 ATGGCCTAATGGTCAAAAGATGG - Intronic
1044769179 8:95611346-95611368 AGGGCCTACTTGAGAGAGGAAGG - Intergenic
1046003384 8:108448320-108448342 ATAGTATACTGGAAAGAACATGG - Intronic
1047169119 8:122473475-122473497 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
1047976206 8:130133251-130133273 ACAGGCTACAGGAAAGAAGAGGG + Intronic
1050362334 9:4842392-4842414 AAGGCCCAATGGAAAGATGAAGG + Intronic
1050975555 9:11933416-11933438 ATGGCCTACTTGAAAGTAGAAGG + Intergenic
1051949056 9:22608585-22608607 GGGGCATACTGGAAAGAATATGG + Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1055356471 9:75442680-75442702 AGGGCCTATTGGAAGGCAGAGGG - Intergenic
1055715936 9:79117975-79117997 ATGTCCTAGTGGAAAACAGAAGG + Intergenic
1056959500 9:91110347-91110369 AGGGCCTACTTGAAGGAAGAGGG + Intergenic
1057920310 9:99091753-99091775 AAGGCATACAGGAAAGAGGATGG + Intergenic
1058777893 9:108303150-108303172 CTGGCCTCCTTGTAAGAAGAGGG + Intergenic
1060053297 9:120392107-120392129 CTGGCCTAATGGAAAGAAAGAGG + Intronic
1061114888 9:128603819-128603841 CTGCCCTACTGGAAATCAGAGGG - Intronic
1061936361 9:133859699-133859721 ATGGGCTGGTGGAAAGGAGAAGG + Intronic
1186189189 X:7052571-7052593 ATGGGGTAATGGAAAGAAAAAGG - Intronic
1187002237 X:15194106-15194128 ATGGCATACTGGAACGAAGGTGG + Intergenic
1187918963 X:24182578-24182600 ATGGGCTATTGGAGAGGAGATGG + Intronic
1189258434 X:39658831-39658853 ATGGCCTACAGCAAAGAACAAGG - Intergenic
1191732878 X:64356104-64356126 ATGGCATAATGGAAAGATCAGGG - Intronic
1192035948 X:67563205-67563227 AGGGCCTTCGGGAAAGAAGCTGG + Intronic
1192239540 X:69318506-69318528 ATGGCATAATGGAAAGAATGTGG + Intergenic
1192575629 X:72241042-72241064 GTGTCACACTGGAAAGAAGAGGG + Intronic
1195591318 X:106630744-106630766 GTGGCCTACTTGAAAGTGGAGGG + Intronic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1197142861 X:123135910-123135932 GGGGCCTACTTGAAAGTAGAGGG + Intergenic
1198564058 X:137885192-137885214 GTGGCCTACTGGAAGGTGGAGGG + Intergenic
1199163159 X:144638169-144638191 AAGGCCTACAGGAAAGAATGTGG - Intergenic
1199271906 X:145893850-145893872 ATGGCCTACTTGAAGGTGGAGGG - Intergenic
1200481856 Y:3714404-3714426 ATAGCCTAGTGGAGAGAAAAGGG + Intergenic
1201294501 Y:12452155-12452177 AGGGCCTACTTGAAGGCAGAGGG + Intergenic