ID: 901348634

View in Genome Browser
Species Human (GRCh38)
Location 1:8570741-8570763
Sequence CAAGCTGCACAGATGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901348628_901348634 22 Left 901348628 1:8570696-8570718 CCCTGGACCATAGTTAAGAATGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 197
901348632_901348634 15 Left 901348632 1:8570703-8570725 CCATAGTTAAGAATGGCTGGTCT 0: 1
1: 0
2: 0
3: 15
4: 193
Right 901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 197
901348630_901348634 21 Left 901348630 1:8570697-8570719 CCTGGACCATAGTTAAGAATGGC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 197
901348627_901348634 23 Left 901348627 1:8570695-8570717 CCCCTGGACCATAGTTAAGAATG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901348634 Original CRISPR CAAGCTGCACAGATGGCTCC AGG Intronic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900888462 1:5432078-5432100 CAAGCTCAACTGATGGCTGCAGG + Intergenic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901774482 1:11550722-11550744 CAAGCTGCAATGATAGCTGCTGG - Intergenic
902479457 1:16704099-16704121 CCAGCTCCACGGATGGATCCCGG + Intergenic
904469807 1:30729348-30729370 CCAGCTGCACTGCAGGCTCCTGG - Intergenic
905445705 1:38027369-38027391 CACCCTGCACATAAGGCTCCGGG - Intergenic
909049665 1:70752920-70752942 CAAGCTGGAGTGATGGCTCAGGG + Intergenic
913485058 1:119326603-119326625 CAAGCTGCACTATTGGCTCAGGG + Intergenic
914750674 1:150532928-150532950 CTAGTTGCACTGCTGGCTCCTGG - Intergenic
920760232 1:208776744-208776766 CAAGCACCACAGATGGCTGCAGG - Intergenic
922130293 1:222771019-222771041 CAAGGTGGACAGATGGCTTGAGG + Intergenic
922573856 1:226649157-226649179 GAACCTGCACCGATGGCTTCAGG + Intronic
1062864184 10:835998-836020 CAGGCTGCACTGGTGGCTCAGGG + Intronic
1062953160 10:1520881-1520903 CAAGCTTTTCAGATGGTTCCTGG + Intronic
1063224794 10:4005459-4005481 CCAGCTGCACAGTGGGCTGCCGG - Intergenic
1065785176 10:29206269-29206291 CAAGATGCACAGAAGGGTGCAGG + Intergenic
1068660843 10:59621934-59621956 CAAGATGGACAGATGGCTGATGG - Intergenic
1071288164 10:84167928-84167950 CAATTTGCAAACATGGCTCCCGG + Intergenic
1071856756 10:89633666-89633688 CAAGCCACACAGCTGGCTTCAGG + Intronic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1074422526 10:113322072-113322094 CAAGCTCCACAGGTGGTTCTGGG + Intergenic
1076055251 10:127367522-127367544 GAAGCTCCACAAAAGGCTCCAGG + Intronic
1076110424 10:127855609-127855631 CTAGCTGAAGAGATGGGTCCTGG - Intergenic
1076141149 10:128079209-128079231 CCAGCAGCACAGTTGGCACCTGG - Intronic
1076315839 10:129540889-129540911 CACAGAGCACAGATGGCTCCAGG - Intronic
1076453281 10:130571806-130571828 CAAAATGCACACCTGGCTCCGGG + Intergenic
1076706090 10:132302423-132302445 CAAGCTGCACAGCTGCCCCAAGG + Intronic
1077722523 11:4642840-4642862 GAGGCAGCAGAGATGGCTCCAGG + Intergenic
1078098600 11:8315405-8315427 CAACCTGGAGAGATGACTCCAGG - Intergenic
1078791082 11:14542803-14542825 CAACCTGCAAAGATGGTTTCTGG - Intronic
1078860065 11:15238837-15238859 CCAGCTGGACAGATGGCTGCAGG - Intronic
1080460303 11:32449124-32449146 TATGCTGCCCAGATGGCTCTGGG + Intergenic
1080881091 11:36321534-36321556 CCAGCTTCAGAGATGGGTCCAGG - Intronic
1082037417 11:47656632-47656654 CAGGCTGCCAAGATGGCTTCGGG - Intergenic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1083739898 11:64703217-64703239 CCAGCTGCTTACATGGCTCCTGG + Intronic
1084121554 11:67071860-67071882 CAGGCTGCACAGGCGGCTCCAGG - Exonic
1084207578 11:67604920-67604942 GATGCTGCAGAGAAGGCTCCTGG + Exonic
1085025919 11:73236589-73236611 CAGGCTGGACAGCTGACTCCAGG + Intergenic
1087008642 11:93493217-93493239 CAGACTGCACAGAAGCCTCCAGG + Intronic
1091106012 11:132920567-132920589 CAGGGTGCACACATGGCCCCAGG + Intronic
1092127485 12:6085115-6085137 GAAGCTGCTCAGATGCCTCCAGG - Intronic
1093706124 12:22276537-22276559 CAAGGTGGCCAGATGGTTCCAGG + Intronic
1094381539 12:29848703-29848725 GAAGCTGGACAGATGGCACCTGG + Intergenic
1094491818 12:30965476-30965498 GAAGCAGGACAGATGGCTCTGGG - Intronic
1097032084 12:56097104-56097126 CAAGCTGCAGAGATGACCCTGGG - Exonic
1097058683 12:56266756-56266778 GAAGCTGCAAAGATGGTTCGGGG - Intergenic
1101092908 12:101305924-101305946 ACAGCAACACAGATGGCTCCAGG - Exonic
1101477675 12:105065955-105065977 TAAGCTGAACTTATGGCTCCAGG + Intronic
1103339758 12:120215196-120215218 CATGCTGTCCAGCTGGCTCCCGG + Exonic
1105305335 13:19164839-19164861 CATGGTGCCCAGATGGCTCTTGG - Intergenic
1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG + Intergenic
1107800971 13:44107692-44107714 CATGCTGCACAGCAGGCTCAGGG + Intergenic
1108379752 13:49844456-49844478 AAAGCTGCGCTGATGGCTCTGGG + Intergenic
1116010762 14:39348899-39348921 GAAGCTCCAAACATGGCTCCTGG - Exonic
1117542779 14:56764597-56764619 TAAGCTGCAAATATGGCTTCTGG - Intergenic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1118995546 14:70832382-70832404 CAATGTCCACAGATGCCTCCTGG - Intergenic
1121561996 14:94882784-94882806 CAGGCTGCACAGACGGCTAGGGG - Intergenic
1122008172 14:98723169-98723191 CAAGCAGCAAACATGGCTTCTGG + Intergenic
1122643669 14:103177437-103177459 GAACCTGCACAGATGTGTCCAGG + Intergenic
1122655812 14:103258551-103258573 GAACCTGCACAGATGTGTCCAGG - Intergenic
1123908467 15:24943412-24943434 CCAGCTGCACCTATGGCTCATGG - Intronic
1128333810 15:66773455-66773477 TAAGCTGCAGAAATGGCTTCAGG - Intronic
1129907128 15:79196190-79196212 CAAACTGCACAGCTGGCTCCAGG + Intergenic
1131493825 15:92885381-92885403 CAAACTGAAGAGATGGCTCATGG - Intronic
1132809613 16:1791238-1791260 CAAGCTGCACAGCCTGCACCTGG - Exonic
1132826169 16:1906729-1906751 CCAGGGGCACTGATGGCTCCCGG + Intergenic
1132860759 16:2070655-2070677 GAAGCTGCAGAGACGGCCCCAGG + Intronic
1133023299 16:2976375-2976397 GACGCTGCACAGCTGGCGCCAGG + Intronic
1134237343 16:12477534-12477556 CTAGCTGAACAGATGGGTACAGG - Intronic
1136080480 16:27849293-27849315 CAAACTGCACTGTGGGCTCCAGG - Intronic
1137690745 16:50425476-50425498 CAAGCTGCAAAGATTCTTCCAGG + Intergenic
1138138083 16:54541231-54541253 GAACCTCTACAGATGGCTCCTGG + Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1140412212 16:74748068-74748090 CAGGCCACACAGATGGCCCCGGG + Intronic
1142687623 17:1586840-1586862 CAAGCTCCAGACATGCCTCCTGG - Intronic
1143491746 17:7289253-7289275 CAAGCTGGTAGGATGGCTCCAGG + Intronic
1143732344 17:8888307-8888329 CCAGCTGCCCAGCTGGCTTCTGG - Exonic
1145209073 17:20999956-20999978 CAAGGTCCACAGAGGGCCCCGGG + Exonic
1145780447 17:27559660-27559682 CCAGATGCCCTGATGGCTCCGGG + Intronic
1146780257 17:35664400-35664422 CATGCTGCACACATGGCTAATGG + Intronic
1147549826 17:41432811-41432833 AAAACAGCAGAGATGGCTCCTGG - Intergenic
1147911225 17:43857409-43857431 GAAGATGCTCACATGGCTCCTGG - Intronic
1148497403 17:48061159-48061181 CAAGGTGGCCAGATGGTTCCAGG + Exonic
1149327578 17:55547912-55547934 CTATCTTCACAGATGCCTCCAGG - Intergenic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1151551280 17:74823858-74823880 CAAGGTGCACAGTTGGATCGAGG + Intronic
1151577921 17:74962195-74962217 CCAGCTGCATTGAGGGCTCCGGG + Intronic
1151684817 17:75640258-75640280 CAAGCTGCAGAGACTGCCCCAGG + Exonic
1152248618 17:79199690-79199712 CAAGAGTCACACATGGCTCCTGG + Intronic
1152469115 17:80481238-80481260 AAAGGTGCACAGATTGCACCTGG - Intergenic
1153816955 18:8799014-8799036 AAAGCTGCTCAGGGGGCTCCTGG + Intronic
1159142821 18:64418216-64418238 CAACCAGCACAAATGGGTCCCGG - Intergenic
1160782491 19:884033-884055 CAAGAGGCCCCGATGGCTCCCGG - Intronic
1162179639 19:8859283-8859305 CAAGCTGGACAGATGGATGGAGG - Intronic
1162783649 19:13020786-13020808 CAAGATGCACGACTGGCTCCTGG - Intronic
1166369337 19:42292571-42292593 CAAGCCCCACTGCTGGCTCCCGG + Exonic
1167116274 19:47491044-47491066 CTGGCTGCAGAGATGGCTGCAGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168087866 19:54061699-54061721 CTAGCTGCTCAGAAGGCTGCGGG + Intronic
1202713496 1_KI270714v1_random:30005-30027 CCAGCTCCACGGATGGATCCCGG + Intergenic
925361104 2:3280905-3280927 GCAGCTGCACAGGCGGCTCCTGG - Intronic
925737822 2:6979648-6979670 CAGGCTCCACAGAAGCCTCCAGG + Intronic
926238444 2:11067538-11067560 CAAGCTCCACAAATGGTTCCAGG + Intergenic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
929769599 2:44880669-44880691 CAAGATACAAAGATGGCTCAGGG - Intergenic
932460584 2:71879528-71879550 GCAGCTGCAGAGATGGCTCTGGG + Intergenic
935672927 2:105570927-105570949 GCAGCTGCACTGCTGGCTCCTGG + Intergenic
936090328 2:109498058-109498080 CAAGGAGGACAGATGGCTGCCGG - Intronic
936236743 2:110748652-110748674 CAGGCTGTGCAGGTGGCTCCTGG + Intronic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
940405835 2:153300969-153300991 CAAGGTGGACAGATAGCTTCAGG + Intergenic
941829990 2:169945462-169945484 GAAGCTGCCCAGATGGCTGAGGG - Intronic
941889778 2:170567973-170567995 CAAGGTGCACTGATGGGTCATGG + Intronic
943496792 2:188630478-188630500 ATAGCTTTACAGATGGCTCCTGG + Intergenic
943963626 2:194301522-194301544 AATGATGCACAGATGACTCCAGG + Intergenic
948308088 2:236964688-236964710 CAAACTGAGCAGATGGCTCAGGG + Intergenic
948516956 2:238510099-238510121 CAAGCTGCAAAGCGGGCACCAGG - Intergenic
948767055 2:240227878-240227900 AAGGCTGCAATGATGGCTCCTGG - Intergenic
1170919096 20:20659243-20659265 CCAGCTGCATAGATGCTTCCAGG + Intronic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1173119882 20:40278991-40279013 CAAGCTGCCCAGATGATCCCAGG + Intergenic
1173561040 20:44005970-44005992 GAAGGTGCACAGGTGACTCCTGG + Intronic
1173948100 20:46967727-46967749 GAAGCAGCTCACATGGCTCCTGG + Intronic
1177271731 21:18857514-18857536 CAAGTTCCACAGGTGCCTCCTGG - Intergenic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1179122102 21:38557391-38557413 GAAGCTACACAGTTGGCCCCTGG + Intronic
1185082541 22:48717949-48717971 CACGCAGGACAGACGGCTCCCGG - Intronic
949729066 3:7086569-7086591 CAAGTTGCACAGAAGTCACCAGG - Intronic
950084669 3:10248776-10248798 CAAGATCCACACATGGCTGCCGG - Exonic
950550634 3:13663970-13663992 CAGGCTGCCCCGATGGCTCAGGG + Intergenic
950606575 3:14086721-14086743 CAAGCTGTCCAGGAGGCTCCTGG + Intergenic
953730751 3:45445488-45445510 CCAGCTTCACAGATGTCTACAGG - Intronic
955050691 3:55407818-55407840 CATGCTCTAAAGATGGCTCCAGG - Intergenic
955326720 3:58014359-58014381 CAAGCTGGACAGGGAGCTCCAGG + Intronic
958180421 3:90052716-90052738 GATGCTGCACAGCTGACTCCTGG - Intergenic
961001675 3:123378426-123378448 CAAGTTGCAGAGAAGGCTCAAGG + Intronic
961828356 3:129610599-129610621 GAAGCAGCAGTGATGGCTCCCGG - Intergenic
963456168 3:145550861-145550883 CAAGCTGAACAGAATGCTCAAGG - Intergenic
965541577 3:169877094-169877116 GAAGCTGCACTTATGGCACCAGG - Intergenic
966579973 3:181550026-181550048 CAAGCAGCACAGATAGCTGAGGG - Intergenic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
968284160 3:197498598-197498620 CCAGCCGCACAGAGGGCCCCAGG + Intergenic
969161772 4:5266362-5266384 AGAGCTGCACAAATGTCTCCAGG + Intronic
969393464 4:6906262-6906284 CAAGCTGCCAAGCTGGCACCTGG - Intergenic
970916718 4:21344370-21344392 CTACATCCACAGATGGCTCCAGG - Intronic
971530693 4:27684912-27684934 GAACCTGCACAGATCGCTCCTGG - Intergenic
971910843 4:32795478-32795500 AAAGCTGCACAGCTAGCACCTGG + Intergenic
976342951 4:83964954-83964976 CAAGCAGCACAGCTGCCACCGGG + Intergenic
977240617 4:94564338-94564360 AAAGCTGCAGAGATGGCTGGGGG - Intronic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
978612455 4:110558525-110558547 CAAGGTGGACAGATGGCTTGAGG - Intronic
982266714 4:153544554-153544576 CAAGCTGGCCTGCTGGCTCCAGG - Intronic
984665394 4:182421933-182421955 CAAGTTGCAAAGCTGGCCCCGGG - Intronic
985531109 5:434277-434299 CAAGGTGTACCGATGCCTCCGGG + Exonic
987111624 5:14693083-14693105 GAAGATGCACAGGTGGCTCCTGG + Exonic
987247158 5:16060480-16060502 AGAGCTGACCAGATGGCTCCTGG - Intergenic
989533219 5:42532204-42532226 CAAGCTGCCCTCATGGCTCAAGG - Intronic
995737129 5:115313298-115313320 AAAGTTACACAGATGGTTCCAGG - Intergenic
997849181 5:137315593-137315615 CCTGCTGCACTGATGGCTCAAGG + Intronic
997973741 5:138426061-138426083 TAAGCTACACAGTTGGCACCAGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000809970 5:165849137-165849159 GGATCTGAACAGATGGCTCCCGG + Intergenic
1002856609 6:1043558-1043580 CACGCTGTACAGAGTGCTCCAGG - Intergenic
1002864358 6:1107944-1107966 CAGGCTGCTTAGATGGGTCCTGG + Intergenic
1004704851 6:18115215-18115237 CATGCTGTATAGATGGCTCCTGG + Intergenic
1005030305 6:21502474-21502496 CAAACAGCACTGAAGGCTCCTGG - Intergenic
1008958810 6:57245006-57245028 CAGGCTGCAGGGATGGCTCCCGG + Intergenic
1010316277 6:74454251-74454273 GAAGCTGGACATGTGGCTCCAGG - Intergenic
1012450512 6:99349370-99349392 CATGCTGCGCGGCTGGCTCCGGG + Exonic
1012556910 6:100524718-100524740 GGAACTGGACAGATGGCTCCAGG + Intronic
1013669001 6:112377662-112377684 TAAGGTGCACTGATGGTTCCAGG - Intergenic
1016878472 6:148887090-148887112 CAAGCAGAACAGATCTCTCCTGG + Intronic
1017905136 6:158752818-158752840 CCAGCTGCCCAGATGGCCCCTGG - Intronic
1019601313 7:1885164-1885186 CCAGCCTCAGAGATGGCTCCGGG + Intronic
1022033772 7:26515708-26515730 CAGGCTGCACAGCCTGCTCCTGG + Intergenic
1022552238 7:31251752-31251774 CAATCTGCACAGGTGCTTCCTGG - Intergenic
1024590811 7:50881256-50881278 AAATCTGCACAGATGGTTCATGG - Intergenic
1028471680 7:91212927-91212949 CATGCTGCACAGATGGCGTAAGG + Intergenic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1029799954 7:102936049-102936071 CCAGCTGTAAAGATGGCACCTGG + Intronic
1029993306 7:104982834-104982856 CAAGCAGCACAGATAACTACTGG + Intergenic
1033534357 7:142298516-142298538 AATGATGCACAGCTGGCTCCAGG + Intergenic
1034386418 7:150744652-150744674 CAACCTGCTCAGAAGCCTCCAGG + Intronic
1035789671 8:2292611-2292633 CAAGGTGGACAGATGGCTTGAGG + Intergenic
1035803134 8:2429094-2429116 CAAGGTGGACAGATGGCTTGAGG - Intergenic
1037625387 8:20601854-20601876 CAAGCTGCCAAGAGGGCTCTGGG - Intergenic
1039300463 8:36203315-36203337 CCAGCTCTTCAGATGGCTCCTGG - Intergenic
1039908412 8:41804185-41804207 CAAGATCCTCAGATGGCTGCTGG + Intronic
1040825502 8:51616234-51616256 AAATCTGCACAGATGGTTTCTGG + Intronic
1044630950 8:94278276-94278298 CAAGCTCCATGGAGGGCTCCTGG + Intergenic
1044726048 8:95195100-95195122 GAAGCTGTCCAGAGGGCTCCAGG - Intergenic
1048460835 8:134620395-134620417 TCAACTGCACAGTTGGCTCCCGG + Intronic
1049353043 8:142174472-142174494 CAGGCTGCACTGTTGGCTGCAGG - Intergenic
1049782184 8:144434145-144434167 CAAGCTGCACACAGCACTCCGGG - Exonic
1053860010 9:42377499-42377521 TCAGCTACACAGATGGCTGCCGG + Intergenic
1057570269 9:96198907-96198929 CAATGTGCACAGGTGGCTCAGGG - Intergenic
1057847042 9:98533747-98533769 CAACCTCCCCAGCTGGCTCCAGG - Intronic
1060361066 9:122958204-122958226 CAAGGTGGCCAGATGGTTCCAGG - Intronic
1061670007 9:132183304-132183326 CAAGCTGCCCATCTGGCTCCTGG + Intronic
1203375522 Un_KI270442v1:372523-372545 CAAGCTGCACAAGCAGCTCCTGG - Intergenic
1186719630 X:12289466-12289488 CAAGATGCACAGATAGCTAGTGG + Intronic
1190016593 X:46832736-46832758 CAAGCTCCAGAGATGGCTCTGGG - Intergenic
1190085528 X:47392260-47392282 CAGCCTACACAGATGGCTGCAGG - Intronic
1190319169 X:49169872-49169894 CAAGATGAATGGATGGCTCCTGG - Intergenic
1193238919 X:79143280-79143302 CAAGCTACTCAGATGGCTGAGGG + Intergenic
1195694258 X:107655197-107655219 CTGGCTGCACAGCTGCCTCCTGG + Intergenic
1195753374 X:108178496-108178518 CAAGCAGAACAGATTGCTGCAGG - Intronic
1200001996 X:153066929-153066951 CAAGATTCACAGAAGGCTCTGGG - Intergenic
1200005736 X:153083096-153083118 CAAGATTCACAGAAGGCTCTGGG + Intergenic