ID: 901352734

View in Genome Browser
Species Human (GRCh38)
Location 1:8612254-8612276
Sequence CAGTGTAATGAGAGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901352734_901352735 1 Left 901352734 1:8612254-8612276 CCAGCAGCTCTCTCATTACACTG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 901352735 1:8612278-8612300 ATTAGATCTGTGTGCCTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 125
901352734_901352739 26 Left 901352734 1:8612254-8612276 CCAGCAGCTCTCTCATTACACTG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 901352739 1:8612303-8612325 TTATGAGAACTCCACATATGGGG 0: 1
1: 0
2: 1
3: 8
4: 173
901352734_901352737 24 Left 901352734 1:8612254-8612276 CCAGCAGCTCTCTCATTACACTG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 901352737 1:8612301-8612323 ATTTATGAGAACTCCACATATGG 0: 1
1: 0
2: 9
3: 16
4: 138
901352734_901352738 25 Left 901352734 1:8612254-8612276 CCAGCAGCTCTCTCATTACACTG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 901352738 1:8612302-8612324 TTTATGAGAACTCCACATATGGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901352734 Original CRISPR CAGTGTAATGAGAGAGCTGC TGG (reversed) Intronic
900197118 1:1382058-1382080 CAGGGAGATGAGAGACCTGCAGG + Intergenic
901352734 1:8612254-8612276 CAGTGTAATGAGAGAGCTGCTGG - Intronic
904302551 1:29563972-29563994 CAGTGTAAAGAAACATCTGCAGG + Intergenic
905943526 1:41883296-41883318 CCTTGCAGTGAGAGAGCTGCTGG + Intronic
906576747 1:46898143-46898165 CTGTGAAATGAGAGAGCCACAGG + Intergenic
906595172 1:47069442-47069464 CTGTGAAATGAGAGAGCCACAGG - Intronic
912213186 1:107577562-107577584 AAGTGTCATGAGACAGCTTCTGG + Intronic
912440168 1:109691675-109691697 GAGTGCAGTGAGAGGGCTGCAGG + Intronic
918477030 1:184935942-184935964 CAGACTAGTGAGAGAGTTGCAGG + Intronic
919547686 1:198943973-198943995 CAGTGCAATGAGAGAGGGGTGGG - Intergenic
923728172 1:236524941-236524963 CAGTATAATGACAGAATTGCTGG + Intronic
924627417 1:245707201-245707223 CAGTGTTATGACATTGCTGCAGG - Intronic
1063497183 10:6520705-6520727 CAGTGCACTCAGAGAACTGCAGG - Intronic
1063581142 10:7308652-7308674 AGCTGAAATGAGAGAGCTGCAGG - Intronic
1063643346 10:7854073-7854095 AAGTGTATTGAGAGATATGCTGG - Intronic
1064951640 10:20857642-20857664 CAGCGTAGTGAGAGTCCTGCAGG + Intronic
1068306422 10:55214909-55214931 CAGTGTAATGGTAGTGCTTCTGG + Intronic
1068544903 10:58334809-58334831 CAGCTTAAGGTGAGAGCTGCCGG - Intergenic
1075708436 10:124517230-124517252 GTGTGGAATGAGAGCGCTGCAGG + Exonic
1078106912 11:8363623-8363645 CTGTGCAAAGCGAGAGCTGCTGG - Intergenic
1079096237 11:17512165-17512187 CAGAGTGGTGAGAGAGCTGGGGG - Intronic
1079483872 11:20913311-20913333 CAATGTAAACAGAGATCTGCAGG + Intronic
1082134009 11:48526775-48526797 CACGGTAATGTGGGAGCTGCAGG - Intergenic
1082141128 11:48610764-48610786 CACGGTAATGCGGGAGCTGCAGG - Intergenic
1082567026 11:54693161-54693183 CACGGTAATGTGGGAGCTGCAGG - Intergenic
1082625392 11:55478316-55478338 CACAGTAATGTGGGAGCTGCAGG - Intergenic
1084268966 11:68019139-68019161 CAGTGCAGGGAGAGAGCTGGAGG - Intronic
1084518535 11:69649152-69649174 CATTTTCCTGAGAGAGCTGCGGG - Intronic
1089097301 11:115930115-115930137 CAGTATAATGAGGGAGCCACAGG + Intergenic
1089650449 11:119909457-119909479 AAGTGGAAAGAGAGAGCTGGTGG - Intergenic
1089780301 11:120869108-120869130 GACTGTGAGGAGAGAGCTGCAGG + Intronic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1092081567 12:5720735-5720757 CTGTGAAATGAGAGAGCAGTGGG - Intronic
1101533011 12:105591757-105591779 AAGTGTGAAGAGAGAGCTGAAGG - Intergenic
1104072164 12:125355303-125355325 CAGAGGAATGAGAAAGCTTCAGG + Intronic
1106112534 13:26789594-26789616 CAGTGAAATGAGAGGACTCCTGG - Intergenic
1106846102 13:33739413-33739435 CATTGTAATATGAGAGCCGCAGG + Intergenic
1107203079 13:37746201-37746223 CAGTGCAATGAGAGAGGGACTGG + Exonic
1114672258 14:24417513-24417535 CAGTGGACTGAGAGCACTGCTGG - Exonic
1115574745 14:34699927-34699949 CACTGTGATGAGAGAAGTGCAGG - Intergenic
1115848934 14:37571998-37572020 CAGTGGAATGACAGAGCTAAGGG - Intergenic
1119560974 14:75589531-75589553 CACTGGCCTGAGAGAGCTGCAGG - Intronic
1120404474 14:84077845-84077867 CAGTGTACTGTGATAGCTCCAGG - Intergenic
1123634723 15:22292677-22292699 CAGAGTAATGAGATAGCTGCTGG + Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128769707 15:70272791-70272813 CAGTGTGATGCGAGGGCCGCAGG - Intergenic
1129114343 15:73356949-73356971 CAGAGCAATCAGAGAACTGCAGG + Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129982099 15:79882566-79882588 CAGTGTACTGAGGTAGCTGCTGG - Intronic
1132465046 16:73530-73552 CAGTGTCAGGAGAGAAATGCTGG - Intronic
1137048079 16:35686763-35686785 CATTCTAATGGGAGAGATGCTGG - Intergenic
1138267645 16:55671381-55671403 CAGTGGAAAGAGAGAGCTCTCGG + Intronic
1140436140 16:74948699-74948721 AAGTCTAAAGAGAGACCTGCTGG + Intronic
1140722926 16:77787728-77787750 CAGTTTAAGGAAAGAGATGCAGG - Intergenic
1161044275 19:2126774-2126796 CAGTGTACTGTGAGAGCGGATGG + Intronic
1161202390 19:3022882-3022904 CACTGTAATGGGAAAGCTGCTGG + Intronic
1161619703 19:5291613-5291635 CAGTGTATTCTGAGAACTGCAGG - Intronic
1163135354 19:15307237-15307259 CAGTGAAGTAAGAGCGCTGCAGG + Intronic
1163981784 19:20907507-20907529 CACTGTAGTGAGTGAGTTGCTGG - Intergenic
1164373007 19:27657940-27657962 CATTCTAATGGGAGAGCTCCTGG - Intergenic
1164374615 19:27674173-27674195 CAGTCTAATGATAGAGATACTGG - Intergenic
1164379472 19:27719725-27719747 CAGTCTAATGATAGAACTCCTGG - Intergenic
1164485635 19:28653494-28653516 CAGTGTCCTGAGGGAGGTGCTGG - Intergenic
1167275825 19:48538713-48538735 CAGTTTGTTGAGAGAGCTGTGGG + Intergenic
1167421035 19:49403451-49403473 CAGTGAGATGTAAGAGCTGCTGG - Intronic
1168634398 19:57984316-57984338 AAGTGTAAGGACAGAGGTGCTGG + Intronic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925867605 2:8242832-8242854 CAATGAAATGAAAGATCTGCGGG - Intergenic
926001710 2:9338755-9338777 CAGTGTAATGAGAGCACTCGTGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
928369852 2:30732830-30732852 CCACGTAATGGGAGAGCTGCTGG + Intronic
931945069 2:67297467-67297489 AAGTGTGATGGGGGAGCTGCAGG - Intergenic
932451704 2:71814684-71814706 CAGTGTGGTGTGAGAGGTGCTGG - Intergenic
933006182 2:76998320-76998342 CAGTCTAACTAGAGAGCTGAGGG + Intronic
933006265 2:76999256-76999278 CAGTCTAACTAGAGAGCTGAGGG - Intronic
935449226 2:103190103-103190125 CAGTGTAGGGAGAGAGCTACTGG - Intergenic
935788192 2:106568010-106568032 CAGAATAATGGGAAAGCTGCTGG + Intergenic
937952523 2:127399442-127399464 CAGTTTAATGAGACTGCTTCTGG + Intergenic
938039935 2:128067388-128067410 CAGTGTAAAGAAGGAGCTCCTGG + Intergenic
938744014 2:134260011-134260033 CAGTGGAAAGAGAGAGGTGGAGG + Intronic
941442181 2:165552329-165552351 CAGATTACTGAGATAGCTGCAGG - Intronic
944667630 2:201970397-201970419 CGGTGGGATGAGAGAGCTGGGGG + Intergenic
948171526 2:235907108-235907130 AAGTGTATTGAGGAAGCTGCTGG - Intronic
1172929284 20:38572489-38572511 CTCTGTGATGAGAGAGATGCAGG - Intronic
1172979722 20:38931767-38931789 CTGTGTGGTCAGAGAGCTGCTGG - Intronic
1174031944 20:47635942-47635964 CAGGGCACTGAGAGAGCTGCTGG - Exonic
1177942276 21:27425461-27425483 CTGGGTAATTAGTGAGCTGCTGG - Intergenic
1182315157 22:29441022-29441044 CAATGTGATGACAGAGGTGCCGG - Intronic
1182547783 22:31085661-31085683 CTGTGTAAGGAGGGAGCTGTGGG - Intronic
1182716467 22:32359731-32359753 CAATGTGATGACAGAGATGCTGG - Intronic
950007543 3:9701184-9701206 GAGTGGAAGCAGAGAGCTGCTGG + Intronic
950554289 3:13685942-13685964 CTGGGCACTGAGAGAGCTGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954212802 3:49107837-49107859 CAGTGGGATGAAAGAGCAGCAGG + Intergenic
955637066 3:61041890-61041912 CAGTATAATGTGAGAACTGAAGG + Intronic
965625385 3:170679256-170679278 CAGTGCCATGAGTGAGCAGCAGG - Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
968180510 3:196591804-196591826 CAGCTGGATGAGAGAGCTGCTGG + Intergenic
974685917 4:65229017-65229039 CAGTGTATAAAGAGACCTGCCGG + Intergenic
979769210 4:124501768-124501790 CAGTATAATGAGAAAACTGAAGG - Intergenic
979930313 4:126621760-126621782 CAATGTAAAGAGAAAACTGCAGG + Intergenic
983155108 4:164337423-164337445 CAGTGTGATGAGTGAGCACCTGG + Intronic
983969915 4:173858851-173858873 AAGTGTACTGAGAGAGGTCCTGG + Intergenic
984023719 4:174518781-174518803 CAGTGTAATGAAAGACATTCAGG - Intronic
984713376 4:182904228-182904250 CAGTGTAATTAGAGTTCTGGGGG - Intronic
987037311 5:14031492-14031514 CAGAGTTATGAGAGTGGTGCTGG - Intergenic
987482929 5:18481753-18481775 CAGTGTAATGTGGGAGTTTCAGG - Intergenic
989132381 5:38120080-38120102 CTGTGTAAAGGCAGAGCTGCAGG - Intergenic
993068895 5:83133940-83133962 CAGTGTGAAGAGAGAGGCGCTGG + Intronic
993081959 5:83312304-83312326 GAGTGTAATGAAAGAGGAGCAGG + Intronic
993571202 5:89540936-89540958 CAGAGTGATTAGACAGCTGCAGG - Intergenic
995227283 5:109715090-109715112 GAGGGTACTGGGAGAGCTGCAGG + Intronic
997724699 5:136110719-136110741 GAGTGTAAGCAGAGAGCTGATGG + Intergenic
999184781 5:149698931-149698953 CAAAGTAATGAGAGAGATGAGGG - Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1001163328 5:169340671-169340693 CAGATTAATAAGTGAGCTGCTGG + Intergenic
1003988758 6:11464719-11464741 CAGTGTTATCAAATAGCTGCTGG - Intergenic
1007744927 6:44037943-44037965 CAGTGTATTGTGAGAGCTCCAGG - Intergenic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1011641171 6:89417763-89417785 CAATGTAATGAAAGAGCAGGAGG + Intergenic
1013786158 6:113783629-113783651 CTGTGTAGTTACAGAGCTGCTGG - Intergenic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1018530041 6:164752668-164752690 CAGAGTATTCAGTGAGCTGCTGG + Intergenic
1020690881 7:11353318-11353340 AAATGCAATGAGAGAGCAGCTGG + Intergenic
1022417683 7:30191972-30191994 CAGTGTAATGTGGGAGGGGCTGG + Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1033359330 7:140626936-140626958 CAGTGAACTTGGAGAGCTGCGGG + Intronic
1034001919 7:147423791-147423813 CAGTGAATTTAGAGAGCTGCAGG - Intronic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036601038 8:10260340-10260362 AAGTGGAGTGAGAAAGCTGCAGG + Intronic
1037760783 8:21740130-21740152 CAGTGTGATGACAGAGCAGCTGG + Intronic
1041553782 8:59130157-59130179 CAGAGAAATGAGAGAACTCCAGG + Intergenic
1043835516 8:85040842-85040864 CATTTTCATGAGAGAGATGCTGG + Intergenic
1045376004 8:101574691-101574713 CACTGCAGTGAGAAAGCTGCTGG + Intronic
1049748901 8:144274376-144274398 CTGTCTCATGGGAGAGCTGCAGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051579484 9:18655273-18655295 CACTGTCATGACAGAGCTGGAGG - Intronic
1051843061 9:21420214-21420236 CTGGGAAATGAGGGAGCTGCTGG - Intronic
1055489747 9:76792480-76792502 GAGAGGAATGAGAGGGCTGCAGG + Intronic
1056956874 9:91089642-91089664 CTGTGTAATCAGAGCCCTGCAGG - Intergenic
1059910101 9:119033645-119033667 CCCTGCAATCAGAGAGCTGCTGG - Intergenic
1186534855 X:10336345-10336367 CAGTGTAATGAATGAGATTCGGG + Intergenic
1187261680 X:17690484-17690506 GACTGTAAGGAGAGAGCTGGAGG + Intronic
1187565516 X:20445718-20445740 CAGTGAAATAATAGAGCTGGTGG + Intergenic
1188233661 X:27699134-27699156 CAGTGTAAAGATAGTGCTGGGGG + Intronic
1191246861 X:58234899-58234921 CATTCTAATGAGAGAGCCTCTGG + Intergenic
1194753735 X:97712968-97712990 CACTGTGCTGAGAGAGCTGATGG + Intergenic
1196655867 X:118216571-118216593 CAGTGTTATTACAGAGCTGTTGG + Intergenic
1197569575 X:128132164-128132186 AAGTTTAATGAGAGCCCTGCTGG + Intergenic
1197747287 X:129940153-129940175 GAGAGTGTTGAGAGAGCTGCTGG - Intergenic
1198789537 X:140328576-140328598 AAGAGTAATGAGAGGGCGGCCGG - Intergenic
1199444754 X:147909651-147909673 CAGTGTAATGAGGAAGCAGAGGG + Intergenic
1199800946 X:151250187-151250209 CAGTCTCAGGAGAGAGCTGGAGG - Intergenic