ID: 901357518

View in Genome Browser
Species Human (GRCh38)
Location 1:8664065-8664087
Sequence TTGTGGACTTTGCAGTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901357518 Original CRISPR TTGTGGACTTTGCAGTTAGT GGG (reversed) Intronic
900597462 1:3488913-3488935 TTTTGTATTTTGCAGTTAGATGG + Intergenic
901255648 1:7823825-7823847 TTGTGGATTATACAGTTACTGGG - Intronic
901357518 1:8664065-8664087 TTGTGGACTTTGCAGTTAGTGGG - Intronic
903805377 1:26001667-26001689 TTGGGGACTTCCTAGTTAGTGGG + Intergenic
905114725 1:35628041-35628063 TTGGTGACTTTGCACTTATTAGG + Intronic
907322466 1:53613715-53613737 GTGTGGACTTTGTAATAAGTGGG - Intronic
909562347 1:77020783-77020805 TTCTGAAATTTGCAGTTAGATGG + Intronic
910333185 1:86098987-86099009 TTGTGTATTTTGCAGTTATTTGG - Intronic
912273762 1:108235653-108235675 TTGTAGAATTTGCATTTAGAGGG + Intronic
912294457 1:108458670-108458692 TTGTAGAATTTGCATTTAGAGGG - Intronic
913204848 1:116528878-116528900 TTGTGGATTTGGCACTTAGGAGG - Intronic
918530593 1:185516228-185516250 TGTTGGACTTTGCAGTCATTTGG + Intergenic
919540396 1:198838194-198838216 TTCTGGACTTTGCAGGTCTTTGG - Intergenic
920768817 1:208859914-208859936 TTGTTGACTTTGTACATAGTTGG + Intergenic
920933132 1:210407453-210407475 TTTTGGAGTTTGCAGATACTGGG - Intronic
922119705 1:222652707-222652729 GTGTGGACTTGGGAGATAGTAGG + Intronic
1064426727 10:15236084-15236106 TTGTGAACTTTAAAGTTATTTGG + Intronic
1070527580 10:77308565-77308587 TTGTCGACTTTGCTGTTATCTGG - Intronic
1070548158 10:77469162-77469184 TTGTGGCCTTTGAAGGTATTGGG - Intronic
1072178952 10:92960489-92960511 CTGTGGACTTTGGAATTTGTGGG + Intronic
1075525097 10:123177529-123177551 TGGTGGTCTTTGCAGCTAGTTGG + Intergenic
1075642419 10:124074375-124074397 TTGTGCCCTTTGCAGTTGGGTGG - Intronic
1078210111 11:9264063-9264085 GTCTGGAGTTTCCAGTTAGTGGG - Intronic
1079978280 11:27120615-27120637 TTGTGGCCTTTGTAGGTACTTGG - Intronic
1088667464 11:112107868-112107890 TTAAGGACTTTGGAGTTTGTAGG - Intronic
1088972157 11:114783075-114783097 TTTTGGACTTTGCAGGGAGCCGG - Intergenic
1096277662 12:50224125-50224147 TATTGGAGTTTGCAGTTTGTTGG - Intronic
1097324015 12:58255530-58255552 TTTTGGACTTTGCAGAGAATTGG - Intergenic
1098389056 12:69949835-69949857 TTGTGGACTCTGGAATTAGATGG + Intronic
1104375501 12:128262656-128262678 ATGTGGACTTTGAAGTCAGATGG + Intergenic
1105560424 13:21485391-21485413 AGGTGGAGGTTGCAGTTAGTTGG - Intergenic
1106000228 13:25715591-25715613 TTGAAGACTTTACAGTAAGTGGG - Intronic
1106686610 13:32067044-32067066 TTGAGGACTCTGCAGTTCCTTGG + Intronic
1106864190 13:33945829-33945851 ATGTGGTGTTTGCAGGTAGTAGG - Intronic
1110596803 13:77328496-77328518 TTCAGGACTTTGCATGTAGTAGG + Intergenic
1111834767 13:93374581-93374603 CTGTGGCCTTTGCAGATATTTGG + Intronic
1112234342 13:97621902-97621924 GTGTGGCCTTTGCACTCAGTGGG + Intergenic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1115287791 14:31735780-31735802 AGGTGGAAGTTGCAGTTAGTCGG + Intronic
1115459044 14:33638629-33638651 GTGAGAACTTTGCAGTTGGTAGG + Intronic
1118475880 14:66116536-66116558 TGGTGGACTTAGCAGATGGTGGG + Intergenic
1118852251 14:69592968-69592990 TTGTGGAATTTGGAGTTAAGGGG - Intergenic
1118866240 14:69705890-69705912 TTGTGGCTTCTGCAGTTACTTGG + Intronic
1121620655 14:95345892-95345914 TTGAAGACCTTGCAGTGAGTAGG + Intergenic
1123409349 15:20045575-20045597 CTGTGGGCTTTGCAGTGAGAGGG - Intergenic
1123518680 15:21052283-21052305 CTGTGGGCTTTGCAGTGAGAGGG - Intergenic
1129278958 15:74468690-74468712 ATTTGGATTTTGCAGTTAATGGG + Intergenic
1130378546 15:83352521-83352543 GTGAGGACTTTGCAATTTGTAGG + Intergenic
1131235774 15:90695908-90695930 AGGTGGAGGTTGCAGTTAGTCGG - Intergenic
1131575225 15:93582770-93582792 TTGTGGTCTTCACATTTAGTAGG - Intergenic
1131664237 15:94553200-94553222 TTCTGGAATTTCCAGATAGTGGG + Intergenic
1136169634 16:28480932-28480954 TTGGTGACTTTGAAGTCAGTGGG - Intronic
1137011060 16:35320555-35320577 TTGTAGTCTTAGCAGTTGGTAGG - Intergenic
1138465717 16:57188194-57188216 ATGTGGACTTTGCATTTCCTGGG + Intronic
1142202777 16:88768977-88768999 GTGTGGCCTTTGCAGTGAATAGG - Intronic
1144662344 17:17079383-17079405 TTGTGGACTTGGCTGGAAGTAGG + Intronic
1144746223 17:17616609-17616631 TGGTGGAGTTTGCTGTTAATGGG - Intergenic
1148147444 17:45374751-45374773 TTGTGGATTTGGCAGTTACATGG + Intergenic
1150028347 17:61703132-61703154 AGGTGGAGTTTGCAGTGAGTTGG - Intronic
1151770083 17:76155050-76155072 CTGTGGACTGTCCAGTGAGTGGG - Intronic
1155909127 18:31488116-31488138 TTATGGACTCTCCAGTTAGATGG - Intergenic
1159678922 18:71322610-71322632 TTGTACACTTTGCAATTTGTGGG + Intergenic
1160037893 18:75318415-75318437 ACGTGGCCTTTGCTGTTAGTAGG - Intergenic
1163384510 19:16991315-16991337 TAGTGGAATTTGCAGCCAGTAGG + Intronic
1163468352 19:17482731-17482753 GTGTGGGCTTTGCACTCAGTAGG + Intronic
925137017 2:1529363-1529385 TTGGGGACGTTGCACATAGTGGG - Intronic
925546233 2:5019869-5019891 TTGTGGACTTTCCTATTATTTGG + Intergenic
928433515 2:31239238-31239260 GGATGGACTTTGCAGTGAGTGGG - Intronic
928477333 2:31642676-31642698 TTGTGGACTTTTCATTTTTTGGG - Intergenic
929671389 2:43878621-43878643 TTGAGGCCTTTGGAGTTAGAGGG + Intergenic
930948098 2:57100747-57100769 TTGTAGACTTTCCAATTTGTTGG + Intergenic
932762460 2:74447733-74447755 TTGGGAACATTCCAGTTAGTTGG - Intergenic
935806019 2:106748403-106748425 TTGGGTACTTTGCCCTTAGTTGG + Intergenic
937183743 2:120019251-120019273 GTGTGGACTTGCCAGTAAGTAGG + Exonic
938131173 2:128716640-128716662 TTGTGGGTTTTGCAGTCAGCTGG - Intergenic
938876122 2:135532340-135532362 TTGTGGGCTTTGAAGTTTTTTGG + Intronic
940272255 2:151903934-151903956 TTGTGGGCTTGGCATATAGTAGG + Intronic
1168956419 20:1837495-1837517 TTGTGGATTTAGCAGGTATTGGG - Intergenic
1174022802 20:47544875-47544897 ATATGGACTTTCCAGTTATTTGG + Intronic
1179224061 21:39436973-39436995 TTGTGAAGCATGCAGTTAGTGGG - Intronic
1183685917 22:39361426-39361448 TTGTGGAGGTTGCAGTGAGTTGG - Intronic
951724815 3:25745594-25745616 ATGTGGAATTTGCAGTCAATAGG - Intronic
952276428 3:31881801-31881823 TTGTGAACTTTGCTGGTTGTTGG - Intronic
954842526 3:53524537-53524559 TAGTGCACTTTTAAGTTAGTAGG + Intronic
955793230 3:62609513-62609535 ATGTGGACTTTGTAGTTAGATGG + Intronic
956992263 3:74780626-74780648 TTGTGGATTTATCAGTAAGTAGG - Intergenic
961001960 3:123379996-123380018 TTGTGTCCTTTGGAGTTAGAGGG - Intronic
962035538 3:131647611-131647633 GCATGGACTTTGGAGTTAGTTGG + Intronic
962297846 3:134208993-134209015 TTGTGGAACTTACAGTGAGTGGG + Intronic
963306051 3:143654473-143654495 TTTTAGACGTTGCAGTTGGTGGG + Intronic
967880211 3:194296658-194296680 TCCTGGCCTTTGCAGTTATTAGG - Intergenic
968260485 3:197319229-197319251 TTGTGGATTTTGCAATAAATAGG - Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
969890804 4:10258102-10258124 ATGTGTACATTCCAGTTAGTAGG + Intergenic
970476375 4:16428058-16428080 TTGTGAAATTTGCATTTAATAGG - Intergenic
970716094 4:18925347-18925369 TTGTTTATTTTGCAGCTAGTTGG - Intergenic
971737819 4:30479742-30479764 ATGTGGGCTTTGAAGTCAGTTGG - Intergenic
975969652 4:80017782-80017804 TTGTGGATGTTGCAGTTTGCTGG - Intronic
976966119 4:91043450-91043472 ATGTGGACTGTGCATTTGGTTGG - Intronic
978261664 4:106767797-106767819 TTGTGGACTTGGAAGGTAGGGGG + Intergenic
978275952 4:106950209-106950231 TTGTAGACTTTCCATTTACTGGG - Intronic
979037418 4:115741195-115741217 TTTTGGACTTTGCATTTATTTGG - Intergenic
980893360 4:138837878-138837900 TTCTAGACCTTACAGTTAGTAGG - Intergenic
981431588 4:144667600-144667622 CTGGGGACTTTGCAGTGAGGTGG - Intronic
982796080 4:159646237-159646259 TTGTGGGTTTTGCAATTTGTTGG + Intergenic
983453169 4:167931531-167931553 TGCTGGACTTTGGACTTAGTTGG + Intergenic
983865021 4:172756148-172756170 TTGTAAACTTTGGAATTAGTTGG - Intronic
987468674 5:18303863-18303885 TCCTGGACTCTGCAGTTTGTAGG + Intergenic
987953030 5:24701301-24701323 TTGAGGACTTTCCAGGTATTTGG + Intergenic
988885963 5:35558528-35558550 TTGTGTACTTTTGAGTTAATGGG - Intergenic
991240235 5:64450369-64450391 TTGTGAACTTTAGAGTTAGCTGG - Intergenic
993306811 5:86284441-86284463 TTGTAGAATTTGCATTTAGAGGG - Intergenic
995444527 5:112227975-112227997 GTGAGCACTTTGTAGTTAGTAGG - Intronic
998391767 5:141791561-141791583 TTGTGGAACTTACAATTAGTGGG + Intergenic
1000383034 5:160646044-160646066 TTGTGGTCTGGGAAGTTAGTAGG + Intronic
1008890558 6:56484670-56484692 TTTTGGACCTTACACTTAGTTGG + Intronic
1010823523 6:80445200-80445222 CCATTGACTTTGCAGTTAGTAGG + Intergenic
1011233130 6:85186453-85186475 TTGTGGGCTTTGCTGGTAATTGG + Intergenic
1011727507 6:90225418-90225440 TTGTGAAATTTAGAGTTAGTGGG + Intronic
1016476009 6:144429058-144429080 TTTTGTACTTAGCAGTTTGTGGG + Intronic
1017688611 6:156940402-156940424 TTGTTGAGTTTGCAATTAGACGG + Intronic
1017871169 6:158487934-158487956 TTGTGGAGTTTGCAGTAGTTGGG + Intronic
1018397787 6:163392888-163392910 TTTTAAACTTTGCAGTGAGTTGG + Intergenic
1018438600 6:163787289-163787311 TTTTGGGCATTGCAGTTTGTAGG - Intergenic
1020924076 7:14302068-14302090 TTGTGGAATTTGCTTTTTGTTGG - Intronic
1025755856 7:64339990-64340012 TTGTGGAGTTTGCTTTTAGTGGG + Intronic
1026483187 7:70796313-70796335 TTGTGTGCTGTGCAGTTATTGGG + Intergenic
1027459895 7:78439166-78439188 TTGTGGAATTTTCAGTTCCTTGG + Intronic
1029242919 7:99177232-99177254 TTGGGGACTTTGTAGTTAACGGG + Intronic
1030002695 7:105082321-105082343 TTGTGGACTGTGCAGGCAGTTGG - Intronic
1030646646 7:112068749-112068771 TTGTAGGCTCTGTAGTTAGTGGG + Intronic
1032987310 7:137352505-137352527 TTATGGACATTGCAGTGACTTGG + Intergenic
1033355600 7:140596692-140596714 TTTTGGTCATTGCAGTTATTTGG + Intronic
1036606983 8:10316286-10316308 TCATGGACTTTGGAGTTAGATGG + Intronic
1036848262 8:12184578-12184600 TTGTTGACTCTGTAGTTAATGGG + Intronic
1036869624 8:12426859-12426881 TTGTTGACTCTGTAGTTAATGGG + Intronic
1037303453 8:17479172-17479194 ATGTGTACTTTGCAATTTGTGGG + Intergenic
1037538033 8:19845506-19845528 ATATGGAGTCTGCAGTTAGTGGG + Intronic
1041990230 8:63979534-63979556 TTCTGGAATTTGGAGTTATTTGG + Intergenic
1044142048 8:88668638-88668660 TTTTGAACTTTCCAGTTAGGTGG + Intergenic
1045662106 8:104448744-104448766 TTTTGCACTTTTTAGTTAGTAGG - Intronic
1045812485 8:106239036-106239058 TTCTGGACTTTTCAGTTATATGG + Intergenic
1048413705 8:134202964-134202986 CTGTGGACTTTGCAGTCTTTGGG - Intergenic
1049764586 8:144348542-144348564 GTGTGGAGTAGGCAGTTAGTTGG - Intergenic
1050063078 9:1730827-1730849 ATGTGGACTTTGCATTTCATTGG - Intergenic
1051077262 9:13254011-13254033 TTGTGGACTCTGGAGCTAGATGG - Intronic
1051691486 9:19717857-19717879 TAGTGGAATTTTCATTTAGTGGG - Intronic
1055357473 9:75452114-75452136 TTGTGGGCTGTGGAATTAGTAGG + Intergenic
1055945898 9:81690337-81690359 GAGTGGACTGTGCACTTAGTTGG + Intergenic
1057048965 9:91907643-91907665 TTGTAGACATTGCAGTGAGTGGG - Intronic
1057102874 9:92379981-92380003 TTTTGGAATTTGCAATTATTTGG + Intronic
1058468136 9:105249273-105249295 TTGTGGAGTTTGAAGTGAGATGG + Intronic
1060304576 9:122399013-122399035 TTTAGGGCTTTGCAGTTAGCAGG - Intergenic
1203769609 EBV:42461-42483 TTGTGGACCTGTCAGTTCGTGGG + Intergenic
1189563651 X:42216904-42216926 GTGTGGGCTTTGCAGTCAGACGG + Intergenic
1193141979 X:78037015-78037037 TTGTGGCCTAAGCAGTTAGAAGG + Intronic
1193170200 X:78327304-78327326 CTGTGGACCTTGAAGTTAGCAGG - Exonic
1193589514 X:83370667-83370689 TTGTGGACTATATAATTAGTAGG - Intergenic
1194207588 X:91030151-91030173 CAGTGGAATTTGCACTTAGTAGG - Intergenic
1197277194 X:124493708-124493730 CTGTTGACTTTCCAGTAAGTAGG + Intronic
1199249899 X:145648733-145648755 TTGGGGACTTTGCACTTATTTGG + Intergenic