ID: 901359672

View in Genome Browser
Species Human (GRCh38)
Location 1:8686313-8686335
Sequence GAATTTCTACGTAATTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901359672_901359673 11 Left 901359672 1:8686313-8686335 CCTAGGGAATTACGTAGAAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 901359673 1:8686347-8686369 ATCAGACACCTATTATGTGCTGG 0: 1
1: 0
2: 4
3: 42
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901359672 Original CRISPR GAATTTCTACGTAATTCCCT AGG (reversed) Intronic
900752455 1:4407230-4407252 GCAAATCCACGTAATTCCCTAGG + Intergenic
901322171 1:8346408-8346430 GAATTTCTACCTGATTCCTTAGG - Intergenic
901359672 1:8686313-8686335 GAATTTCTACGTAATTCCCTAGG - Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
903516814 1:23916729-23916751 GCATTTCTAACTAATTCCCAGGG + Intergenic
904779717 1:32936654-32936676 GAATTTCTCAGAATTTCCCTGGG + Exonic
914413146 1:147451447-147451469 GAATTTCTCAGTAATCCACTTGG - Intergenic
915849232 1:159303241-159303263 GGATTTCAACGTAAGTTCCTTGG + Intronic
916538118 1:165723693-165723715 GAATTTTTACTTAATTTCTTTGG - Intergenic
917362987 1:174197458-174197480 GAGTTTCCACGTAATACACTTGG + Intronic
918518664 1:185390115-185390137 GAAATTCTACATAAATACCTTGG + Intergenic
918840212 1:189526151-189526173 GAGTTCCTATGTAATTCCCAGGG + Intergenic
922210525 1:223483179-223483201 TAATTTCTACTTCATTCCATTGG + Intergenic
923173813 1:231444074-231444096 GGATTTCTATTTCATTCCCTAGG - Intergenic
1063235981 10:4117147-4117169 GCACTTCCACGTAATTTCCTTGG - Intergenic
1065290726 10:24226981-24227003 GAATTTCTACCTAACTTACTTGG + Intronic
1065940543 10:30560541-30560563 GAATGTTTATGTATTTCCCTGGG + Intergenic
1066263022 10:33747487-33747509 GATTTTCTAAGTAAATACCTAGG - Intergenic
1068241836 10:54312533-54312555 AAATTTCTGCCTAATTCTCTTGG + Intronic
1069164994 10:65143942-65143964 GAGTTTCAACGTAATTCTTTTGG - Intergenic
1069574047 10:69513840-69513862 GAATTTCCACTGAATTGCCTTGG + Intergenic
1077604750 11:3601893-3601915 GAAATTATTCGTAATACCCTAGG + Intergenic
1079127307 11:17726984-17727006 CAATGGCTACATAATTCCCTGGG + Intergenic
1080175095 11:29353894-29353916 GCATTTCCATGTAATTTCCTGGG + Intergenic
1082936782 11:58663975-58663997 GATCTTGTTCGTAATTCCCTGGG - Intronic
1083030871 11:59590866-59590888 GAATTTCTAGGTATTTGCCCTGG - Intronic
1084807980 11:71592142-71592164 GAAATTATTCGTAATACCCTAGG - Intronic
1084812125 11:71618757-71618779 GAAATTATTCGTAATACCCTAGG - Intergenic
1084845090 11:71892162-71892184 GAAATTATTCGTAATACCCTAGG - Intronic
1085959046 11:81437438-81437460 GAATATCTATGTAATTACCACGG + Intergenic
1086661473 11:89424326-89424348 AAATTTTTCCGTAATTCTCTTGG + Intronic
1086816963 11:91383856-91383878 GAATTTGTACTTGATTCACTAGG + Intergenic
1086817103 11:91385764-91385786 GAATTTGTACTTGATTCACTAGG + Intergenic
1088240877 11:107772667-107772689 AACTTTCTAAGAAATTCCCTTGG + Intergenic
1092431908 12:8417029-8417051 GAAATTATTCGTAATACCCTAGG + Intergenic
1094157778 12:27355593-27355615 GAACTTCTACATACTTCCCTGGG + Intronic
1097715228 12:62959279-62959301 GAATTTCTTCATCAGTCCCTGGG + Intergenic
1102410965 12:112718408-112718430 GACTTTAGACATAATTCCCTGGG - Intronic
1105326776 13:19377514-19377536 AAATACCTACGTATTTCCCTAGG + Intergenic
1105380438 13:19882208-19882230 CACTTTCTTAGTAATTCCCTGGG - Intergenic
1106998553 13:35517525-35517547 GAATTTCTAAGTAATTCAAATGG - Intronic
1108852638 13:54752558-54752580 GAATTTTTTCTTAATTCCCTAGG + Intergenic
1115462697 14:33679375-33679397 AACTTTTTAAGTAATTCCCTTGG - Intronic
1125466229 15:39955759-39955781 GAAGGTCTAGGTAAGTCCCTGGG + Exonic
1126494328 15:49273747-49273769 AAATTTCTAGGTTATTACCTGGG - Intronic
1131509644 15:93042716-93042738 GAATTTCTTCCTGATTCACTGGG + Intronic
1133619015 16:7508306-7508328 TATTTTCTGCGTTATTCCCTAGG + Intronic
1136286480 16:29247134-29247156 AAATTTCAACCTACTTCCCTGGG + Intergenic
1140887045 16:79253459-79253481 TAATTTCTATGTAATCCCTTAGG + Intergenic
1141835642 16:86537470-86537492 GAATTTCTACATATTTCTCTAGG + Intronic
1145839697 17:27984312-27984334 GCATTTATACGTATTTCCCCAGG + Intergenic
1147349190 17:39826805-39826827 GAATTTGGACATATTTCCCTTGG + Intronic
1147353888 17:39875483-39875505 GAATATATAAGTAATTCACTTGG + Intronic
1153939023 18:9961004-9961026 AAACTTCCACCTAATTCCCTTGG + Intergenic
1156583964 18:38410966-38410988 TAATTTCTATGTAATTCCTGAGG + Intergenic
1159437705 18:68440099-68440121 GAATTTCTCAGTATTTCACTGGG - Intergenic
928148249 2:28802766-28802788 GAATTTCTAAATAAATCCCCTGG + Exonic
931592312 2:63898479-63898501 CATTTTCTTCGTACTTCCCTAGG - Intronic
932354058 2:71053866-71053888 GAAATTATTCGTAATACCCTAGG - Intergenic
932819549 2:74887751-74887773 GAATTGCTACTTGATTCACTTGG - Intronic
934181373 2:89624955-89624977 GAAATTCTACATAATTACGTAGG + Intergenic
935848598 2:107194564-107194586 GATTTTCAACTTAATTCCCTTGG + Intergenic
940269140 2:151872476-151872498 GAATTTCCACTTGATTTCCTAGG + Exonic
941158998 2:162014122-162014144 GAATTCCTTTGAAATTCCCTTGG + Intronic
942069040 2:172298772-172298794 TGATTTCTTTGTAATTCCCTTGG + Intergenic
943775416 2:191760467-191760489 GAATCTCTAAGTAATTCCTTAGG + Intergenic
947521686 2:230850377-230850399 GAATCTCTGCGTAAGTCCCCAGG - Intergenic
948286120 2:236786849-236786871 GAATTTCAACCAAAGTCCCTGGG + Intergenic
1170149519 20:13215212-13215234 GAATGTCTATTTAATTCTCTGGG + Intergenic
1170315264 20:15034172-15034194 TAATGTCTTCTTAATTCCCTAGG - Intronic
1173120393 20:40283824-40283846 GACTTTCTCTGTAATGCCCTTGG + Intergenic
1174947650 20:55006000-55006022 CAATTTCTAAGTAATTACTTTGG - Intergenic
1177003025 21:15636572-15636594 GACTTTATACATAATTCCTTTGG - Intergenic
1182953462 22:34398825-34398847 GAATTTTTACTTAATTCCATTGG + Intergenic
949820026 3:8106153-8106175 AAATTTTTAAGTAATACCCTAGG + Intergenic
957075598 3:75600901-75600923 GAAATTATTCGTAATACCCTAGG + Intergenic
957266919 3:77979038-77979060 AAATTTCTACGTAAATCTATTGG - Intergenic
957298044 3:78356899-78356921 CAATTTCCATGCAATTCCCTAGG - Intergenic
959493920 3:107026757-107026779 AAATGTATGCGTAATTCCCTCGG - Intergenic
961278500 3:125745851-125745873 GAAATTATACATAATACCCTGGG - Intergenic
962627775 3:137244008-137244030 TAATTTCTTTGTAATTCTCTAGG + Intergenic
962727776 3:138250300-138250322 GAATATCTAAGTAATTCATTGGG + Intronic
964622166 3:158729319-158729341 GAATTTTTACTTTATTCACTCGG + Intronic
965950044 3:174297886-174297908 CTATTTCTACATATTTCCCTTGG + Intergenic
968988263 4:3891550-3891572 GAAATTATTCGTAATACCCTAGG + Intergenic
969023891 4:4158727-4158749 GAAATTATTCGTAATACCCTAGG + Intergenic
969729933 4:8948346-8948368 GAAATTATTCGTAATACCCTAGG - Intergenic
969734799 4:8980134-8980156 GAAATTATTCGTAATACCCTAGG - Intergenic
969789532 4:9482456-9482478 GAAATTATTCGTAATACCCTAGG - Intergenic
969794010 4:9511623-9511645 GAAATTATTCGTAATACCCTAGG - Intergenic
972592108 4:40497654-40497676 GAATTTATAAGTATTTCTCTGGG - Intronic
972603538 4:40593462-40593484 GATTTTCTAAGCGATTCCCTTGG - Intronic
976712424 4:88086660-88086682 GAAATTCTAGGTAATTCTTTGGG - Intergenic
982371663 4:154639974-154639996 GATTTTCTAAATAATCCCCTGGG - Intronic
984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG + Intronic
999305449 5:150516445-150516467 GAAATTCTACCTACTTCCCAAGG - Intronic
1000498483 5:162017352-162017374 GGATTTCTACTTAATTTCTTTGG + Intergenic
1001892007 5:175347401-175347423 GAGTTTCTCCTTAGTTCCCTTGG - Intergenic
1002028962 5:176414271-176414293 GCATTTCTTAGGAATTCCCTGGG + Intronic
1008456471 6:51716718-51716740 GAATTTATCAGTATTTCCCTGGG + Intronic
1009472476 6:64044927-64044949 AAATTTAGACCTAATTCCCTTGG + Intronic
1009678235 6:66855693-66855715 GATTTTCTACGTAGGTTCCTTGG - Intergenic
1015373092 6:132478546-132478568 GCATTTCTGAGTAATTCCCAGGG - Intronic
1015867982 6:137747095-137747117 CAATGTCTCTGTAATTCCCTGGG + Intergenic
1017126713 6:151071544-151071566 GAAGTTCAACGTGCTTCCCTGGG - Intronic
1020502125 7:8936606-8936628 GAATTTCTGCGTAATACCTTGGG + Intergenic
1020702584 7:11501485-11501507 TAATTTCTATGTAATTGTCTGGG - Intronic
1022830933 7:34066055-34066077 GAATTTCTCCCTTATTGCCTGGG + Intronic
1029919943 7:104252414-104252436 GAATTTTTGCTTCATTCCCTGGG - Intergenic
1036832873 8:12035868-12035890 GAAATTATTCGTAATACCCTAGG + Intergenic
1036903030 8:12686289-12686311 GAAATTATTCGTAATACCCTAGG + Intergenic
1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG + Intergenic
1040628566 8:49181109-49181131 GAATGTCTATGTAAATCACTTGG - Intergenic
1043685675 8:83083711-83083733 AAATTACTACGTATCTCCCTGGG + Intergenic
1044507036 8:93033708-93033730 GAATTTTTAGGTAAAACCCTTGG + Intergenic
1046341378 8:112861322-112861344 GAATTTGTACTTTATTCCATCGG - Intronic
1047863040 8:128989903-128989925 GAATTTCCACTTAATTCACTTGG + Intergenic
1049934470 9:487933-487955 GAATTTCTGCTTCACTCCCTAGG + Intronic
1050370306 9:4914577-4914599 GAATTTCTAAGTAATTTATTTGG + Intergenic
1050661475 9:7887998-7888020 AAATTTCTGGTTAATTCCCTTGG + Intronic
1050716714 9:8536652-8536674 TAATTTCTACTTAATTACCTAGG + Intronic
1050787543 9:9424431-9424453 GAATTTCTACACAATGCCGTGGG - Intronic
1056033406 9:82578702-82578724 GAATTTCTATTTTATTCCATTGG - Intergenic
1060013891 9:120069542-120069564 ATTTTTCTAAGTAATTCCCTGGG + Intergenic
1199788572 X:151128188-151128210 GAATTTCTAATAAATTCTCTGGG - Intergenic