ID: 901361333

View in Genome Browser
Species Human (GRCh38)
Location 1:8703298-8703320
Sequence GGCTAGGGAGGCGGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361319_901361333 11 Left 901361319 1:8703264-8703286 CCGGGAGGCGGTGGCCGCGCGGG 0: 1
1: 0
2: 1
3: 62
4: 399
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361323_901361333 -3 Left 901361323 1:8703278-8703300 CCGCGCGGGGCCCCGCCCGCGGC 0: 1
1: 0
2: 1
3: 90
4: 591
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361314_901361333 28 Left 901361314 1:8703247-8703269 CCGGCGGCTTGGCGGCTCCGGGA 0: 1
1: 0
2: 1
3: 10
4: 108
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361312_901361333 29 Left 901361312 1:8703246-8703268 CCCGGCGGCTTGGCGGCTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361333 Original CRISPR GGCTAGGGAGGCGGCCGCCC TGG Intronic
900161387 1:1225588-1225610 GGCTGGGGACGGGGCCACCCGGG + Intronic
900252130 1:1676361-1676383 TGCTAGGTAGGCGGCGGCTCGGG - Exonic
900262540 1:1739219-1739241 TGCTAGGTAGGCGGCGGCTCGGG - Exonic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
903323204 1:22554696-22554718 GGCTGGGAAGGCGGCCGCGGTGG + Intergenic
903777374 1:25801179-25801201 GGCTGGGGAGGAGGGCGCCTTGG + Intronic
904261346 1:29289554-29289576 GGCTGGGGAGGGGGCTGGCCAGG - Intronic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
904672895 1:32179607-32179629 GGCCTCGGAGGCGGGCGCCCCGG - Intergenic
905043214 1:34976998-34977020 GGCCAGGCGGGCAGCCGCCCTGG + Intergenic
906290922 1:44618756-44618778 GGCAAGGGAGGAGGTCGGCCAGG + Intronic
906532818 1:46533205-46533227 GGCCAGGGTGGCGGCCGCGCCGG - Intergenic
909931100 1:81501642-81501664 GGCGGAGGAGGCGGCCGCTCAGG - Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
915463034 1:156081144-156081166 GGCTGGGGAGGGGGCATCCCTGG - Intronic
915616845 1:157045815-157045837 GGGAAGGGGGGCGGCCGGCCGGG - Intergenic
918216072 1:182392357-182392379 GGCTAGGGCGGGTGCCGCGCGGG + Intergenic
919788508 1:201275408-201275430 GGCTAGGGTGCCAGCTGCCCTGG + Intergenic
921060278 1:211579104-211579126 AGCTAGAGAGGCGGCGGCCACGG + Intergenic
922555159 1:226527340-226527362 GGGTAGGGAGGCAGCCCTCCAGG + Intergenic
922795202 1:228336332-228336354 GGGCAGGGAGGAGGCTGCCCAGG + Intronic
922796822 1:228343593-228343615 GGCCAGGGAGGTGGGGGCCCAGG + Intronic
924384436 1:243488640-243488662 GGCTGAGCAGACGGCCGCCCCGG - Intronic
924602998 1:245507715-245507737 GGCTGGGAAGGCTGCCTCCCGGG - Intronic
1063929806 10:11017893-11017915 CGCTCGGCAGCCGGCCGCCCCGG + Intronic
1065025035 10:21533916-21533938 GGCGGGGGAGGTGGACGCCCAGG - Intergenic
1065101596 10:22336549-22336571 GGCAAGGGAAGCGGCTGCCGCGG - Intergenic
1067077205 10:43194947-43194969 GCCTGGGGAGGAGGCAGCCCTGG - Exonic
1067752117 10:48978404-48978426 TGCTAGGGATGTGGCCGTCCTGG + Intronic
1068866834 10:61903371-61903393 CCGAAGGGAGGCGGCCGCCCCGG - Intronic
1068955568 10:62816750-62816772 GGCTAGGGAGGCGGAGCCGCCGG - Intronic
1070776209 10:79111301-79111323 GGCAAGGGAGGAGGCAGGCCAGG + Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1072656769 10:97335022-97335044 GGGGAGGGAGGCCGCGGCCCAGG - Intergenic
1074923804 10:118046775-118046797 GGCGGGGAACGCGGCCGCCCCGG + Intergenic
1076371795 10:129960052-129960074 GGATCGGGAGCCGCCCGCCCGGG + Intronic
1076698691 10:132259078-132259100 GGCTTGGGAGGCTGCTGCACCGG + Intronic
1076750107 10:132538099-132538121 GGCGGGGAAGGCGGCCGCCCCGG + Exonic
1076793886 10:132789612-132789634 GGCTGGGGTGGGGACCGCCCAGG + Intergenic
1076979455 11:196933-196955 GGGCAGGGAGGGGGCCGCCTGGG - Exonic
1077219859 11:1411083-1411105 GGCTTTGGAGGAGGCAGCCCAGG + Intronic
1077490179 11:2857479-2857501 GGCAGGAGAGGCGGCCGCCAGGG + Intergenic
1077501919 11:2913181-2913203 GGCTGGGGGGGCGGCGGGCCTGG - Intronic
1079406974 11:20156308-20156330 GGCGAGGGGGGCAGCGGCCCTGG + Exonic
1081488360 11:43548250-43548272 GGACAGGGACGCGGCCGCCGAGG - Intergenic
1081576046 11:44319159-44319181 GGCCTGGGAGCCGGCCGCCCTGG - Intergenic
1083595190 11:63915675-63915697 GGCGGGGGAGGTGGCCGGCCTGG + Intronic
1083657031 11:64234680-64234702 GGCTCGGGAGGGGGCCGCGGAGG + Exonic
1083753756 11:64778238-64778260 GGCGGGGGCGGCGGCGGCCCGGG + Exonic
1083766619 11:64844508-64844530 GGCGAGGCCGGCGGCTGCCCGGG - Exonic
1083877441 11:65531736-65531758 GGCTGGGGAGGCACCTGCCCTGG + Intronic
1084119938 11:67063047-67063069 GGCTTGGGAGGAGGTCACCCAGG - Intronic
1085396436 11:76209255-76209277 GGCCCGGGAGGCGGCCGCCTGGG + Intronic
1089507258 11:118972061-118972083 GGCTGGGGAGCCGTCTGCCCCGG - Intronic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1092205464 12:6612158-6612180 GGCTAGAGAGGCTGCCCTCCTGG - Intergenic
1092659450 12:10722890-10722912 GGCTAAAGAGGCGGCGGCCGCGG + Exonic
1094155380 12:27332921-27332943 GGCTGCGGTGGCGGCCGCCGCGG + Intronic
1096118428 12:49069979-49070001 CGCCAGGGAGCCGGGCGCCCGGG + Exonic
1096262861 12:50103914-50103936 GGGTGGGGAGGCTGGCGCCCAGG - Exonic
1096372857 12:51083384-51083406 GGCTAGGGCGGCGGCGGCAGCGG - Exonic
1096403190 12:51324113-51324135 GGCCAGGGCGGCGGCCCCCAGGG - Exonic
1096826564 12:54283081-54283103 GGTTATGGAGGAGGCGGCCCTGG + Exonic
1096994443 12:55830075-55830097 GGCGAGGGAGGGGGCCAGCCGGG - Intronic
1097240242 12:57570015-57570037 GGCTGGGGAGGAGGCAGCCCTGG + Exonic
1097978685 12:65714966-65714988 AGCTAGGGAGGCAGCAGCCTAGG - Intergenic
1103488148 12:121296590-121296612 GGCAAGGGACGCAGCCGCCGCGG - Intronic
1104785228 12:131444530-131444552 GGATGGAGAGGCTGCCGCCCCGG + Intergenic
1104903803 12:132203117-132203139 GGCTGGGGAGGGGTCCGCACTGG + Intronic
1105207539 13:18236002-18236024 CGCTAACGAGGTGGCCGCCCAGG + Exonic
1105389211 13:19959200-19959222 GGCGGGGGTGCCGGCCGCCCGGG + Intronic
1112050713 13:95642069-95642091 GGCTGTGGCGGCGGCGGCCCGGG - Exonic
1112499370 13:99930651-99930673 TGCTAGGAAGGCGGTGGCCCAGG + Intergenic
1113377514 13:109779329-109779351 GGCAGGGCAGGGGGCCGCCCAGG + Intronic
1117548427 14:56811485-56811507 GGCTCGGGCGGCGCCAGCCCAGG - Intergenic
1118379420 14:65205379-65205401 GGCTAGGGAGGAGCCACCCCAGG + Intergenic
1118489819 14:66247992-66248014 GGCTGGGGAGCCTGCAGCCCAGG + Intergenic
1118728839 14:68652420-68652442 GGCTGGGGAGGGGGCCGTCCAGG - Intronic
1119519705 14:75277117-75277139 GGCCGGGGAGGCCGCGGCCCAGG + Intergenic
1121465352 14:94112010-94112032 GGCTAGGCAGGAGGAGGCCCGGG - Intronic
1122230952 14:100306178-100306200 GGGTAAGGAGGCGGCGGGCCGGG - Exonic
1122558005 14:102591979-102592001 GCCAGGGGAGGCGGCCGCCTGGG + Intergenic
1122786380 14:104166099-104166121 GGGTGGGGAGGCGCTCGCCCTGG + Intronic
1123040318 14:105487690-105487712 GGGCAGGGAGGCGGGCGCCCGGG - Intronic
1125679237 15:41520576-41520598 GGCCAGGGAGTCGGCAGTCCAGG + Exonic
1125793221 15:42385686-42385708 GGCCAGGTAGGCAGCTGCCCTGG - Intronic
1128072524 15:64806697-64806719 GGCCAGGGAGGCAGCCACCTGGG + Intergenic
1128241743 15:66105997-66106019 GGGGAGGGAGGAGGCCTCCCTGG + Intronic
1128309768 15:66622539-66622561 GGCCAGGGAGGGGGCCGCCCTGG - Intronic
1128796088 15:70467782-70467804 GGCAAGGGAGGTGGCCACCGAGG - Intergenic
1129351210 15:74956860-74956882 GGCTAGTGAGGCTGGGGCCCGGG - Exonic
1130370966 15:83284831-83284853 GGGGCGGGAGGCGGCCTCCCGGG - Intergenic
1132500003 16:280947-280969 GGCTTGGGAAGCGGCGGCGCTGG + Intronic
1132555043 16:568645-568667 GGCTGGGGAGGCTGCAGGCCTGG - Exonic
1132602412 16:779572-779594 GGCTGGGGAGACGGCTTCCCCGG - Intronic
1132759206 16:1500747-1500769 GGCTGGAGAGGCAGCCGCTCGGG - Intronic
1132889532 16:2196876-2196898 GGCTGGGGACGCGGCCGCCGGGG + Intergenic
1135040456 16:19113948-19113970 GGCCCGGGAGGGGGCCGACCCGG + Intronic
1136470006 16:30473737-30473759 GGGTGGGGAGGCAGCCCCCCAGG + Intronic
1136641499 16:31569279-31569301 GGCTAAAGAGGCGGCGGCCGCGG + Intergenic
1138344032 16:56309017-56309039 GGCTTGGGAGGAAGCAGCCCTGG + Intronic
1142051202 16:87959503-87959525 TGCGAGGGAGGCGGCTGACCAGG + Intronic
1142136013 16:88452460-88452482 GGCGCGGGAGCCGGCAGCCCTGG - Intergenic
1142188458 16:88706090-88706112 CGCGAGGCCGGCGGCCGCCCCGG - Intronic
1142350068 16:89575735-89575757 GGCTCGGGCGGCCGCCGCGCGGG - Intergenic
1142474501 17:181154-181176 GGCTTGGCTGGCGGCCGCGCGGG + Exonic
1142762278 17:2049781-2049803 GCGCAGGGAGGCGGCCTCCCGGG - Intergenic
1142764082 17:2056125-2056147 GGCCCGGGCGGCGGCCGCGCGGG - Intronic
1142855116 17:2724756-2724778 GGAGAGGTAGGCGGCCGCCTCGG + Intergenic
1143015384 17:3888769-3888791 TGCGAGGGAGGCGGCCGGCCGGG + Intronic
1145242851 17:21249721-21249743 GGCTAAGGAAGGGGCTGCCCAGG + Intronic
1145909171 17:28532821-28532843 GGCTGGGGTGGGGGCTGCCCTGG + Intronic
1145937949 17:28726175-28726197 GGCGGGAGAGGCGGCCGGCCTGG - Exonic
1147486361 17:40818892-40818914 GGCTACGGGGGCGGCAGCTCCGG - Exonic
1147486398 17:40819021-40819043 GGCTACGGAGGCGGAAGCTCCGG - Exonic
1147686353 17:42288793-42288815 GGCCAGGGAGGGCGCCGTCCTGG + Intronic
1147956536 17:44138420-44138442 GGGTAGGGGGGCGGCCCCCTAGG + Intergenic
1148786803 17:50149639-50149661 GGCTTGGGGGGCGGCCGGGCAGG + Exonic
1149712565 17:58756303-58756325 GGCGACGGCGGCGGCAGCCCCGG + Exonic
1151495669 17:74456795-74456817 GGCCAGGGAGATGGCCGGCCTGG + Intergenic
1151559135 17:74861462-74861484 CGCGAGGGAGGCGGCCGGCGCGG - Intronic
1152628130 17:81397586-81397608 GGCTCGGGAGGCGCCGGCCGGGG + Intronic
1152850180 17:82629230-82629252 GGCAAGGGAGGCGGCCCTCTAGG + Intronic
1156448724 18:37254446-37254468 GGCGAGGGGGGCGGCCGGGCCGG - Intronic
1157260737 18:46173980-46174002 GGCTAGAGAGGCAGCTGCGCCGG - Intronic
1157425437 18:47580560-47580582 GGCCAGGAAGGGGGCCTCCCTGG + Intergenic
1158534199 18:58292499-58292521 GACTAGGGTGGGGGCAGCCCAGG - Intronic
1160160400 18:76466248-76466270 GGAGAGCGAGGTGGCCGCCCGGG - Intronic
1161075273 19:2282272-2282294 GGCAGGGGAGGCGGCGGCCTCGG - Intronic
1161307932 19:3577756-3577778 GGCTAGAGCGGCGGGCGTCCAGG - Intronic
1161457000 19:4374603-4374625 GGCCAGGGAGGAGGCTGTCCCGG - Intronic
1161478617 19:4499655-4499677 GGCCGGGGAGGAGGCCCCCCAGG + Exonic
1162315602 19:9936468-9936490 GGCGGGGGAGGCGGCGGCGCAGG - Exonic
1162442637 19:10702265-10702287 GGGTAAGGAGGCGGCTCCCCAGG - Intronic
1162861135 19:13506409-13506431 GGCTCAGAAGGCGGCTGCCCGGG + Intronic
1162944262 19:14032534-14032556 GGCTTTGGAGGTGGCCGCTCAGG + Intronic
1163153532 19:15428268-15428290 GAGGTGGGAGGCGGCCGCCCCGG + Intronic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1163633683 19:18429081-18429103 GGCTTGGGCGGCCTCCGCCCTGG - Intronic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1165790998 19:38492536-38492558 GGCTCATGAGGCGGCTGCCCAGG - Exonic
1166113982 19:40641525-40641547 GTCCAGGGAGGAGGCCGGCCGGG + Intergenic
1167149639 19:47701517-47701539 GGACAGGGAGGAGGACGCCCGGG - Exonic
1167696234 19:51017052-51017074 GGCTGTGGAGGCGGCCTCCAGGG - Intronic
1168254355 19:55157646-55157668 GGTCAGTGAGGGGGCCGCCCGGG + Exonic
925609845 2:5693340-5693362 GGCTCGGGCGGCGGCGGCGCGGG + Exonic
929075264 2:38075245-38075267 GGCAACGGAGGCGGCAGCTCCGG - Exonic
931052305 2:58428487-58428509 GGCGCGCGCGGCGGCCGCCCCGG - Intergenic
933698545 2:85237997-85238019 GGCGAAGGAGGCTTCCGCCCTGG + Intronic
933858459 2:86441536-86441558 GGCCCGGGAGACGGGCGCCCGGG + Intronic
935265104 2:101387176-101387198 GGCCCGGGCGGCGCCCGCCCGGG + Exonic
945259143 2:207828246-207828268 GGCTAGTTAGGAGGCCGCTCTGG + Intergenic
946235740 2:218323459-218323481 GGCTCGGGAGGCGGGCGCGCTGG + Intronic
947751619 2:232535570-232535592 GGCCAGGGAGGAGGCCACTCAGG + Exonic
948115851 2:235494054-235494076 TGCCAGGGAGGGGGCCGGCCGGG + Intergenic
948793980 2:240392833-240392855 GGCCAGGGAGGGGAGCGCCCGGG - Intergenic
1172155322 20:32820058-32820080 GGCTGGGGGGGCGGCCGCGTGGG + Intronic
1174287672 20:49483944-49483966 GCCCCAGGAGGCGGCCGCCCTGG - Intergenic
1174353690 20:49984674-49984696 GGCTAGGGAGGGGGCGGACCCGG - Intronic
1174396186 20:50248186-50248208 GGCCAAGGAGGGGGACGCCCTGG - Intergenic
1175240054 20:57540524-57540546 GGCTGGGGAGGCTGCAGCTCAGG - Intergenic
1175429359 20:58891201-58891223 GCGGAGGGAGGCGGCCCCCCGGG - Intronic
1176222304 20:63975438-63975460 GGCTAGGGAGGAGGCCAAGCTGG - Exonic
1180809574 22:18749434-18749456 CGCTAACGAGGCCGCCGCCCAGG + Intergenic
1180827387 22:18873399-18873421 CGCCAGGGAGGACGCCGCCCAGG - Intergenic
1181037968 22:20179030-20179052 CTCTGGGGAGGCGGCCGCTCAGG + Intergenic
1181057844 22:20268294-20268316 GGCGAGGGCGGCGGCGGCGCGGG + Exonic
1181073911 22:20361841-20361863 GGCTAAGGAGGACGCCGCCCAGG + Intronic
1181309067 22:21933956-21933978 GGCGAGGGTGGGGGCCCCCCAGG - Intronic
1181768815 22:25111403-25111425 GGCGGTGGCGGCGGCCGCCCAGG - Intronic
1182051049 22:27313118-27313140 GGGTCGGGAGGAGGCAGCCCAGG + Intergenic
1182278008 22:29202477-29202499 GGGGAAGGAGGCTGCCGCCCAGG + Intergenic
1182453418 22:30434432-30434454 GGCAAGGGAGGCAGCTGGCCCGG + Intergenic
1184265445 22:43343563-43343585 GCCTAGCGAGCCGGCCGGCCAGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950449043 3:13055274-13055296 GGGTAGCGAGGCGGAAGCCCTGG + Intronic
950483968 3:13261838-13261860 TGCTAGGGACGCAGCCACCCAGG - Intergenic
950796018 3:15511357-15511379 GGCTTAGGAGCCGGCTGCCCTGG - Intronic
952835718 3:37600432-37600454 GGCTAGGGAAGAGGCCACCTTGG - Intronic
954602057 3:51877797-51877819 GGGTAGGGAGGAGGCACCCCAGG + Intergenic
954634758 3:52065433-52065455 GGCTTGGGAGCCGGCTGGCCTGG + Intergenic
957438930 3:80216990-80217012 GGTTAGGGAGGAGGCGGCCCTGG + Intergenic
961831411 3:129624958-129624980 GGATAAGAAGGCGGCAGCCCTGG - Intergenic
967858236 3:194134225-194134247 GGCTCTGGCGGCGGCCTCCCTGG - Intergenic
968512835 4:1002983-1003005 GGCTCTGGAGGGGGCGGCCCGGG + Intronic
970202896 4:13627532-13627554 GGCGGGGGAGGCGGCGGCGCCGG + Exonic
971364548 4:25967302-25967324 GACTAGGGAGGCCCCCGCACTGG - Intergenic
972579300 4:40380522-40380544 GTCTGGGGAGGCGGCAGCCATGG + Intergenic
978618681 4:110619444-110619466 GGCTTTGCAGGCGGCCACCCAGG + Intronic
984206409 4:176792603-176792625 GGCGAGGGAGGACGCCGCCGCGG + Exonic
984801803 4:183722990-183723012 GCCGAGCGAGGCGGGCGCCCTGG + Intergenic
985563992 5:606210-606232 GGCTCAGGAGGCAGCAGCCCTGG + Intergenic
986184450 5:5422814-5422836 GGCCTGGCAGGCGGCGGCCCCGG + Exonic
986315315 5:6583081-6583103 GCCTAGGGCGGCGCCGGCCCGGG + Intergenic
987050210 5:14142894-14142916 CACTAGGGAGGCACCCGCCCCGG + Intergenic
987108705 5:14664888-14664910 GGCGCGGGAGGCGGCGGCCACGG + Exonic
987132430 5:14871891-14871913 GGCTGGGGAGGGGGCCGGGCCGG + Intergenic
997647101 5:135488981-135489003 GGCCGGGGAGGAGGCCGCCGAGG + Intergenic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
999274414 5:150319400-150319422 GGCAGGGGAGGGGGCTGCCCAGG + Intronic
1001544567 5:172563064-172563086 GGCCAGTGAGGCGGAAGCCCAGG + Intergenic
1002101963 5:176862207-176862229 GGCGAGGGAGGGAGCAGCCCTGG - Intronic
1002139932 5:177132574-177132596 GGCTGGGGACTCGGCCTCCCTGG + Intergenic
1002477043 5:179472934-179472956 GGATAGGGACGTGGCCGGCCAGG + Intergenic
1003049300 6:2765604-2765626 GGGGAGGGCGGCGGCCGCCATGG + Exonic
1006502097 6:34465782-34465804 GGCTGGGGAGGAGGGCGCACCGG + Intergenic
1006911154 6:37564504-37564526 GGCTATAGAGGCGACTGCCCAGG - Intergenic
1007406992 6:41640841-41640863 GGCTAGGGAGCCAGGCTCCCGGG - Intronic
1007819893 6:44553522-44553544 GGCCAGGGTGAAGGCCGCCCTGG + Intergenic
1018908855 6:168090413-168090435 GGCTAGGGTGGCTACAGCCCAGG - Intergenic
1019430411 7:996487-996509 GGCTGGGCAGGAGGCGGCCCCGG + Intergenic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1019533088 7:1513338-1513360 GGCTGGGCAGGCGGCTGCCACGG + Intergenic
1019606127 7:1911110-1911132 GGAGGGAGAGGCGGCCGCCCAGG - Intronic
1022446981 7:30478749-30478771 GGCCCGCGAGGCAGCCGCCCCGG - Exonic
1023937268 7:44748878-44748900 GGCGCGGGTGGCGGCGGCCCCGG + Intronic
1024247220 7:47479574-47479596 AGCCAGGCAGGCGCCCGCCCCGG + Intronic
1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG + Intronic
1029737185 7:102471513-102471535 AGGGAGGGAGGCGGCGGCCCAGG - Intronic
1031043555 7:116862938-116862960 GGGGAGGGCGGCGGCTGCCCAGG + Intronic
1032511020 7:132472570-132472592 GGCTTGGGAGGCGGTCGGCTGGG - Intronic
1033406371 7:141074019-141074041 GGGGCGGGAGGCGGCCGCGCTGG + Intergenic
1033654377 7:143362827-143362849 GGCCGGGGAGGGGGCGGCCCGGG + Intergenic
1034830639 7:154305004-154305026 GGCTGGGGAGGGGGCCGCGGAGG - Intronic
1034977620 7:155457627-155457649 GGCGAGGGCGGCGGACGGCCGGG + Intergenic
1035125963 7:156607816-156607838 GGCAGAGGAGGCGGCGGCCCGGG + Intergenic
1035388029 7:158487686-158487708 GGCCAGGGGTGCGGCAGCCCAGG - Intronic
1039109735 8:34028663-34028685 GGATAATGAGGCAGCCGCCCAGG - Intergenic
1039776690 8:40744261-40744283 GGCTAGGGACACGGACTCCCTGG - Intronic
1040564906 8:48556398-48556420 CGCTAGGGAGGCCGGCGCCCGGG + Intergenic
1043388246 8:79768293-79768315 GGCGACGGCGGCGGCCGCGCTGG + Intergenic
1045113090 8:98951767-98951789 GGCTAGGGATGCGACCCCCTGGG - Exonic
1045847883 8:106658318-106658340 GGCCGGGGTGGCGGCCGCCGGGG + Intronic
1047771546 8:128033993-128034015 GGCTGGGGAGGTGGCCGGCAAGG - Intergenic
1049277787 8:141728549-141728571 GGCTGGGGCTGCGGCCGGCCAGG - Intergenic
1049569143 8:143360165-143360187 GGGGTGGGAGGCGGCCGGCCGGG + Intergenic
1049661291 8:143820821-143820843 GGGAAGGCAGGCGGCCTCCCTGG - Intronic
1049733169 8:144189532-144189554 GGCTGGGCAGGTGGCCACCCAGG - Intronic
1051855364 9:21559427-21559449 GGCTAGGGAGGCGCCCCTCAAGG - Intergenic
1052341201 9:27366030-27366052 GGCTAAGGAGGAGGCAGGCCAGG + Intronic
1053435141 9:38069223-38069245 GGCTCGGGAGGCGGCGGCAGTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1058467521 9:105244504-105244526 CGCTGAGGAGGCGGCGGCCCGGG + Intergenic
1060965738 9:127711532-127711554 TGCAAGGCAGGAGGCCGCCCTGG + Intronic
1061015990 9:127980998-127981020 GGCTAGGCGGGCGGCCGCGCGGG - Intergenic
1061665647 9:132159743-132159765 TGCTAGGGAGGAGGCACCCCTGG + Intergenic
1061941294 9:133885600-133885622 AGCTTGGGAGGGGTCCGCCCTGG - Intronic
1061991268 9:134160016-134160038 GGGTGGGAGGGCGGCCGCCCTGG + Intergenic
1062146493 9:134992391-134992413 GGCGAGGGAGCCCCCCGCCCCGG + Intergenic
1062272093 9:135714358-135714380 GGCTAGGGCGGGGGCTGCGCAGG - Intronic
1062339005 9:136085598-136085620 GGCCTGGGAGGCGGCTGCCAGGG + Intronic
1062354950 9:136157538-136157560 GGCATGGGAGGCGGCCACGCTGG - Intergenic
1062493731 9:136821881-136821903 GGCCACGGTGGCGGCCGCACCGG - Intronic
1062497956 9:136840477-136840499 CCCCAGGGTGGCGGCCGCCCGGG - Exonic
1062644154 9:137538212-137538234 TGCTGGGGAGGCTGCCGGCCTGG - Intronic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1188811381 X:34657191-34657213 GTCTGCGGAGGCGGCCGGCCGGG + Exonic
1192260566 X:69504101-69504123 GGAGAGGAAGGCGGGCGCCCGGG + Intergenic
1200119541 X:153783856-153783878 GGCCATGGAGGCTGCCACCCAGG + Exonic
1201240505 Y:11953604-11953626 GGGGAGGGAGGCGTGCGCCCGGG + Intergenic