ID: 901361333

View in Genome Browser
Species Human (GRCh38)
Location 1:8703298-8703320
Sequence GGCTAGGGAGGCGGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361314_901361333 28 Left 901361314 1:8703247-8703269 CCGGCGGCTTGGCGGCTCCGGGA 0: 1
1: 0
2: 1
3: 10
4: 108
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361323_901361333 -3 Left 901361323 1:8703278-8703300 CCGCGCGGGGCCCCGCCCGCGGC 0: 1
1: 0
2: 1
3: 90
4: 591
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361312_901361333 29 Left 901361312 1:8703246-8703268 CCCGGCGGCTTGGCGGCTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239
901361319_901361333 11 Left 901361319 1:8703264-8703286 CCGGGAGGCGGTGGCCGCGCGGG 0: 1
1: 0
2: 1
3: 62
4: 399
Right 901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361333 Original CRISPR GGCTAGGGAGGCGGCCGCCC TGG Intronic