ID: 901361353

View in Genome Browser
Species Human (GRCh38)
Location 1:8703378-8703400
Sequence GGCATGTGGCAGTGCTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 342}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361353_901361364 25 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361353_901361357 -6 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361357 1:8703395-8703417 CATGCCGGTGACCCAGACGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
901361353_901361363 22 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361353_901361365 28 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361353_901361358 -5 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361358 1:8703396-8703418 ATGCCGGTGACCCAGACGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361353 Original CRISPR GGCATGTGGCAGTGCTGGCC CGG (reversed) Intronic
900154209 1:1197612-1197634 GGCATGCGGCATGGGTGGCCCGG - Exonic
900186055 1:1333783-1333805 GGCATCGGGCAGGGCTGGGCTGG - Exonic
900300485 1:1974428-1974450 GGCACGCGGGAGTGCAGGCCAGG - Intronic
900935942 1:5766430-5766452 GGCTTGTGGGAGGGCTGCCCTGG - Intergenic
900947600 1:5840202-5840224 GGCAGGGGGCAGAGCTGCCCAGG + Intergenic
901000039 1:6144353-6144375 GGGATGTGGCAGAGCTGGAGAGG + Intronic
901070283 1:6513532-6513554 GGAATGTAGCTGTGCTGGCTTGG - Intronic
901219405 1:7574660-7574682 GGCACGGGACAGAGCTGGCCAGG - Intronic
901361353 1:8703378-8703400 GGCATGTGGCAGTGCTGGCCCGG - Intronic
901704510 1:11063296-11063318 GGGATCTGGCAGGGCTGGCCAGG - Intergenic
902724143 1:18323988-18324010 GGGATGGGGCAGCGCTGGACAGG - Intronic
902805084 1:18855958-18855980 GTAATGTTGCAGTGCAGGCCGGG - Intronic
903275506 1:22218847-22218869 GGCAGGTGGAAGTGCTGGGCTGG + Intergenic
903817529 1:26075660-26075682 GGCTTGTGGAAGTGCTTCCCTGG + Intergenic
906878035 1:49559039-49559061 GGCATGTGGCAAAGCCAGCCAGG - Intronic
908705332 1:66947753-66947775 TGCAGGTGGCCTTGCTGGCCTGG - Intronic
910220879 1:84888746-84888768 GGCAGGTGGCAGGGCTGGGTTGG - Intronic
910926558 1:92403840-92403862 GGCATTTCACTGTGCTGGCCAGG - Intergenic
911967109 1:104383533-104383555 GCCATGTGGCAGTACAGCCCAGG - Intergenic
912240048 1:107897073-107897095 GGCAGGTGTCAGTGCTGCTCCGG - Intronic
912336265 1:108865935-108865957 GGCATATGGCAGGGATGGCAGGG + Intronic
912536961 1:110381464-110381486 GGCATGTGCCACCACTGGCCTGG + Intronic
914490528 1:148148056-148148078 AGCAGGTGGCAGGGCTGGGCTGG + Intronic
914985945 1:152457287-152457309 AGCATGGGGCAGGGCTGGCCTGG - Intergenic
915139802 1:153760351-153760373 GGAGTGTGGCAGTGATGGCTGGG - Exonic
916341906 1:163745688-163745710 GGCAACTTCCAGTGCTGGCCTGG - Intergenic
917061615 1:171048195-171048217 GGCATGTGGCAAAGCCAGCCAGG + Intronic
917370706 1:174290405-174290427 GGCATGAGGCTGTTTTGGCCTGG + Intronic
917932257 1:179830806-179830828 GGTATGTGAAAGTGCTGGCAGGG + Intergenic
919781867 1:201226218-201226240 GGACTGTGGCAGGGATGGCCTGG + Intronic
919885175 1:201928448-201928470 GGTATGTGGCTATGATGGCCTGG - Intronic
920429268 1:205905949-205905971 GACATGTGTAAGTGCTGGCTGGG + Intergenic
920987902 1:210907775-210907797 GGTATGTGTCAGTAGTGGCCAGG + Intronic
923310435 1:232729601-232729623 GGCATTTGGCCATGTTGGCCAGG + Intergenic
923753562 1:236769773-236769795 GATGTGAGGCAGTGCTGGCCAGG - Intergenic
924613361 1:245591843-245591865 GGCGTGGGACAGGGCTGGCCAGG - Intronic
1063199704 10:3776119-3776141 GGTGTGTGGCAGGGCTGGCTGGG + Exonic
1063445476 10:6111884-6111906 GCTATGTGGCAGTGCAGGTCCGG + Intronic
1064127467 10:12675870-12675892 GCCCTGTGGCAGTACTGGCCTGG - Intronic
1066335163 10:34469336-34469358 GGCAGGTGGAACTCCTGGCCAGG - Intronic
1066560241 10:36662187-36662209 GTGATGTGGCAGTGCAGGGCCGG + Intergenic
1067686107 10:48466755-48466777 GGCCTGGGGCGGCGCTGGCCGGG - Intronic
1069893172 10:71664517-71664539 GGCAGGTGGGAGGGCTGGCCTGG + Intronic
1071086837 10:81875272-81875294 GGCATGGGGCCGCGCGGGCCGGG - Intergenic
1071490367 10:86132083-86132105 GGGATGTGACAGTGCTGTCATGG + Intronic
1071817962 10:89251923-89251945 GGCAAGCGGCAGCGCTGGTCTGG - Exonic
1072071369 10:91921065-91921087 GGCATATGCCAGTTCAGGCCAGG - Intergenic
1072435053 10:95407170-95407192 TCCATGTGGCAGAGGTGGCCAGG - Intronic
1072505049 10:96057502-96057524 GGAATGGGGCAAGGCTGGCCTGG - Intronic
1073289086 10:102404591-102404613 GGCGGGTGGCAGCGCTGGGCAGG + Exonic
1075243270 10:120798133-120798155 GGGGTTTCGCAGTGCTGGCCCGG + Intergenic
1076216289 10:128696203-128696225 TGCCTGTGGCTGGGCTGGCCTGG - Intergenic
1076782173 10:132730373-132730395 GGCTGGTGGACGTGCTGGCCGGG + Intronic
1077168066 11:1152611-1152633 GGCAGGAGACAGTGCTGCCCTGG + Intergenic
1077268609 11:1664769-1664791 GGCATGTGGCAGTGGCTGACAGG + Intergenic
1077272167 11:1686534-1686556 GGCATGTGGCAGTGGCTGACAGG - Intergenic
1077377776 11:2213345-2213367 GGCATGGGGGAGGGCTGGGCAGG - Intergenic
1077650389 11:3966159-3966181 GGAATTTTGAAGTGCTGGCCTGG + Intronic
1077688325 11:4318279-4318301 GGCTTGTGGCAGTACAGCCCAGG + Intergenic
1078524929 11:12092984-12093006 GGGATGTGGCAGTGCACCCCAGG - Intergenic
1079097479 11:17520293-17520315 GGGCTGTGGCTGTGCTGTCCTGG - Intronic
1079230701 11:18646390-18646412 GGCTTGTGGCAGTACAGCCCAGG - Intergenic
1081536064 11:43997088-43997110 GGCATGAGCCACTCCTGGCCAGG + Intergenic
1083234189 11:61341508-61341530 GCCATGGGTGAGTGCTGGCCTGG + Exonic
1084215762 11:67646088-67646110 GGCAGGTGGGAGGGCGGGCCAGG - Intronic
1084700013 11:70780337-70780359 GGCTCATGGCAGAGCTGGCCTGG - Intronic
1085266107 11:75239032-75239054 GGCATGTTGCTGTGTGGGCCGGG + Intergenic
1085499993 11:77011448-77011470 GGCTTCTGGCAGTGTGGGCCAGG - Intronic
1086129059 11:83382329-83382351 GGCAGGTGGCAGAGCCAGCCAGG - Intergenic
1088566349 11:111177021-111177043 GGCTGATGGCAGTGGTGGCCTGG + Intergenic
1090480204 11:127061244-127061266 GCCATGGGCCAGTGCTGGCTGGG + Intergenic
1090942607 11:131400958-131400980 GGCAGGTGGCAGGGGTGGCAGGG - Intronic
1092281997 12:7104627-7104649 GGCATGAACCAGTGCTGGACAGG - Intronic
1093584340 12:20819376-20819398 GCCTTGTGGCAGTGCAGCCCAGG + Intronic
1094850987 12:34382279-34382301 GGCATGAAGCAGGGCTGCCCAGG + Intergenic
1094855294 12:34400202-34400224 GGCATGAACCAGTGCTGCCCAGG - Intergenic
1096114573 12:49048036-49048058 GGTATGTGGCAGCTTTGGCCGGG - Exonic
1096149722 12:49301272-49301294 GGCAGGTGGCAGAGCAGGCCAGG - Intergenic
1096680479 12:53252297-53252319 TGGATGTGGCAGGGCTGGGCAGG + Intronic
1097218489 12:57432306-57432328 GGCAGGAGGCAGTGATGACCAGG - Intergenic
1098046800 12:66408904-66408926 GGCCTGGAGCAGTGGTGGCCAGG + Intronic
1100004505 12:89877959-89877981 GACATGTGGCTGCTCTGGCCAGG + Intergenic
1101835109 12:108289541-108289563 GGCTTCTGGCAGTCCAGGCCAGG - Exonic
1103930871 12:124450119-124450141 GGCATTCAGCAGTGCTGGCCTGG + Intronic
1103989738 12:124790856-124790878 GGCTGCTGGCAATGCTGGCCCGG + Intronic
1104223108 12:126805138-126805160 GGCATGTGAATGTTCTGGCCTGG + Intergenic
1105256075 13:18744733-18744755 GGGATGGGACAGTGCTGCCCAGG - Intergenic
1106660161 13:31791152-31791174 GGCATCTGGAAGTGCTGGAATGG - Intronic
1108202880 13:48059741-48059763 GGCTTGTGGCAGTACAGCCCAGG - Intronic
1108506143 13:51114076-51114098 GCCATGTAGCAGTGCTGGGCTGG + Intergenic
1112900825 13:104354695-104354717 GGAATGTGGAAGGGCTGGCCTGG - Intergenic
1113514979 13:110887384-110887406 GGCTTATGGGAGTGCTGACCAGG + Intronic
1113639145 13:111944698-111944720 GGCAGGCGGCTGAGCTGGCCAGG - Intergenic
1114407644 14:22471685-22471707 GGCAGGCGGCAGTGCAGGCCTGG - Intergenic
1119177406 14:72579299-72579321 GGCACATGACAGTGATGGCCAGG - Intergenic
1119460813 14:74801732-74801754 GGCATGTGGGAATGTAGGCCTGG + Intronic
1120169658 14:81236141-81236163 GGCCAGTGCCAGTTCTGGCCGGG + Intergenic
1121045008 14:90781510-90781532 GGCCTGTGGCTGGGCTGGGCCGG + Intronic
1121626656 14:95390078-95390100 GGCATGTGGCAATGTTGACAAGG + Intergenic
1122206138 14:100148946-100148968 GGTATGTGGCTGGGCTGGCAGGG - Exonic
1122826875 14:104374848-104374870 GCCCTGGGGCTGTGCTGGCCAGG + Intergenic
1123035311 14:105469568-105469590 GGCACCTGGCAGGGCTGGCCAGG - Intronic
1123796755 15:23780386-23780408 GAGATGTGGCAGCGCTGGACTGG + Intergenic
1123882309 15:24687945-24687967 GGCTTGTGGCAGTACAGCCCAGG + Intergenic
1124054257 15:26227141-26227163 TGCAGGTGGCAGTGCAGGGCAGG + Intergenic
1124149547 15:27165272-27165294 AGCATTGGGCAGTGCTGGCGAGG + Intronic
1124638770 15:31382119-31382141 GGCATGTGAGAGTGGAGGCCTGG - Intronic
1126108429 15:45161980-45162002 CGCATGTGGCATGTCTGGCCAGG - Intronic
1126740536 15:51772416-51772438 GGGATGTGGATGTGTTGGCCTGG + Intronic
1126893492 15:53232824-53232846 GGTCTGTGGCAGAGGTGGCCAGG + Intergenic
1127114104 15:55706955-55706977 GGCATTTGGTAGTTCTGGGCTGG - Intronic
1127353250 15:58173444-58173466 TGTATGTTGCAGTGCTGGCTTGG - Intronic
1128548854 15:68584830-68584852 GGCATGGGGCAGGCCTTGCCAGG + Intronic
1129716088 15:77851946-77851968 GAGAAGTGGCAGAGCTGGCCTGG - Intergenic
1130658703 15:85812795-85812817 GGCATGAGCCACTGCAGGCCCGG + Intergenic
1131029475 15:89174475-89174497 TGCATGGGGCTGTGCCGGCCTGG + Intronic
1132507243 16:317253-317275 AGCCTGTGGCGGTGCTGGGCAGG + Intronic
1132628156 16:902170-902192 GGCGTGTGGCAGAGCAAGCCTGG - Intronic
1132630649 16:915665-915687 GACAGGGTGCAGTGCTGGCCAGG + Intronic
1133270185 16:4607513-4607535 TGCATGAGGCAGCGCTGTCCAGG - Intergenic
1134628101 16:15737301-15737323 GGCTTGTGGGAGGCCTGGCCTGG + Intronic
1137716095 16:50599115-50599137 GTGATGAGGCAGTGCTGGGCTGG + Intronic
1139094735 16:63691809-63691831 GGGATTTTGCCGTGCTGGCCAGG - Intergenic
1139223942 16:65215883-65215905 GGCATGTGGCAGTGCAGCCTTGG - Intergenic
1139631395 16:68234066-68234088 GGGATGTGGCTTTGCTGGGCGGG - Exonic
1139948319 16:70656761-70656783 GGCAGGTGGTGCTGCTGGCCTGG + Intronic
1140030561 16:71334926-71334948 GGCAGGTGGCTGAGCTGGCCTGG - Intergenic
1140110850 16:72003636-72003658 GGCCTGTGGCAGTTGTTGCCTGG - Intergenic
1140862763 16:79033531-79033553 CGCATGTGGTAGTGAGGGCCAGG - Intronic
1141641117 16:85342083-85342105 GGGAGGTGGCAGTGATGGGCTGG - Intergenic
1141728475 16:85806619-85806641 GGCAGGTGGCTCTGCTGACCTGG + Intronic
1141894793 16:86952504-86952526 GGCACTTGGCACAGCTGGCCTGG - Intergenic
1142126987 16:88415165-88415187 TTCATGAGGCAGTGCTGGCCCGG + Intergenic
1142210699 16:88807112-88807134 GGTAGCCGGCAGTGCTGGCCTGG - Exonic
1142375804 16:89706621-89706643 GGCAGGTGGCAGGGCTGGTGGGG - Intergenic
1142617780 17:1146592-1146614 GTCATGTGGCAGTGGTGGCATGG - Intronic
1142617795 17:1146666-1146688 GTCGTGTGGCAGTGGTGGCCTGG - Intronic
1142617824 17:1146809-1146831 GTCGTGTGGCAGTGGTGGCCTGG - Intronic
1144398763 17:14873718-14873740 GGCATGTGACAGTGTGTGCCTGG + Intergenic
1144782749 17:17816113-17816135 GGGATGTGGCAGTGGTTACCAGG - Intronic
1144965483 17:19074863-19074885 GGCAGGTGGCAGGGATGACCAGG - Intergenic
1144982484 17:19177320-19177342 GGCAGGTGGCAGGGATGACCAGG + Intergenic
1144985739 17:19200919-19200941 GGCAGGTGGCAGGGATGACCAGG - Intergenic
1145868789 17:28257106-28257128 GGAATGTGGCTCTCCTGGCCAGG - Intergenic
1146574289 17:33978128-33978150 TGAATGTGCCTGTGCTGGCCAGG + Intronic
1146712411 17:35054070-35054092 GGCATTAGGTAGGGCTGGCCAGG - Intronic
1146719815 17:35116214-35116236 GGGCCCTGGCAGTGCTGGCCTGG - Intronic
1147248740 17:39139729-39139751 GGCATGTGTCAGAGCCGGACAGG - Exonic
1147332383 17:39706521-39706543 GGCATGTGGGTGTGCTGGAATGG + Intronic
1147880826 17:43652261-43652283 GGGTTGTGGCAGTGCTGGGTGGG - Intronic
1148207423 17:45787877-45787899 GGCGTGCGGGACTGCTGGCCTGG + Intronic
1148244592 17:46022161-46022183 GGGATTTGGCTGTGTTGGCCAGG - Intronic
1148688883 17:49515443-49515465 GGCATTCGGCAGGCCTGGCCTGG + Intergenic
1148809121 17:50279132-50279154 GGGATGGGGGAGTGGTGGCCAGG + Intronic
1149414665 17:56446941-56446963 GGCATGAGCCACTGTTGGCCTGG - Intronic
1150226416 17:63527047-63527069 GGCAGGTGCCAGTGCGGGGCAGG - Intronic
1152043959 17:77923799-77923821 GGCATGTGGCGGTGCCAGGCTGG + Intergenic
1152341827 17:79729903-79729925 GGCAGGTGGCAGGGGTGGCAGGG - Intergenic
1152515920 17:80824926-80824948 GGCATGTGGCAAGGCCGGCGTGG + Intronic
1152825578 17:82462639-82462661 TGCAGGTGGCAGGGCTGCCCTGG + Intronic
1152898393 17:82926319-82926341 GGGAGGTGGCAATGTTGGCCCGG - Intronic
1154434957 18:14335945-14335967 GGGATGGGACAGTGCTGCCCAGG + Intergenic
1156156625 18:34310283-34310305 AGCATCTGGCCGTGTTGGCCAGG + Intergenic
1156357214 18:36352026-36352048 AGTATGTGCTAGTGCTGGCCTGG + Intronic
1156368016 18:36447403-36447425 GGCATGTGACAGTACTGTCTGGG + Intronic
1160894871 19:1397624-1397646 GGCACGTGGCAGGGCAGCCCTGG + Intronic
1160905247 19:1448988-1449010 AGCCCCTGGCAGTGCTGGCCCGG + Intronic
1160995086 19:1878765-1878787 AGCAGGTGGCAGGGCTGGGCTGG - Intronic
1161208764 19:3055806-3055828 CGCAAGTGGCAGGGCTGGGCCGG - Intronic
1161981603 19:7633037-7633059 GTGAAGTGGCACTGCTGGCCAGG - Intronic
1162107046 19:8376081-8376103 AGCATGGGGCAGTGCTCGTCAGG - Intronic
1163420667 19:17212056-17212078 GGCAGGTGGGAGGGCAGGCCTGG - Exonic
1165117710 19:33538902-33538924 GGCAGGAGGCAGGGGTGGCCAGG - Intergenic
1166122427 19:40693627-40693649 GGCAGGTGGCAGAGCTGGGACGG - Intronic
1166749541 19:45158444-45158466 GGCACGGGGCAGGCCTGGCCTGG + Intronic
1167295699 19:48647873-48647895 GGCATTTGGCCATGTTGGCCGGG - Intergenic
1167306860 19:48714580-48714602 GGGAAGAGGCAGTGCTGGGCGGG + Intronic
1167490613 19:49790858-49790880 GACCTGTGGGAGTGCTGGACAGG + Intronic
1167561086 19:50226591-50226613 GGGATGAGGGAGTGCAGGCCCGG + Intronic
1168224099 19:54982206-54982228 GAGATGTGGAAGAGCTGGCCTGG + Exonic
1168436055 19:56317704-56317726 GGCAGGTGGCAGGGCTGGGGCGG + Intronic
925388122 2:3477112-3477134 GGCCTGTGGCAGAGGAGGCCTGG - Intronic
925476948 2:4227825-4227847 GGCATCTCGCAGGGCTGGTCGGG + Intergenic
926627234 2:15102369-15102391 GGGATGAGGCAGAGCTGTCCTGG - Intergenic
927306333 2:21577327-21577349 TTCTAGTGGCAGTGCTGGCCTGG + Intergenic
927820039 2:26256247-26256269 GGCATGTGCCTGTGCTGAGCAGG + Intronic
928834712 2:35529920-35529942 AGCCTGTGACAGTGGTGGCCAGG - Intergenic
929610704 2:43268829-43268851 GGCAGGTGCCAGTGCTGGCTGGG + Intronic
931943360 2:67277655-67277677 GCCAGGTGGCAGTGCTGGCCGGG + Intergenic
932598302 2:73107776-73107798 GGCCTGTGGCACTGCTGGGGAGG - Intronic
933288321 2:80408251-80408273 GACATGTGGAAGTACAGGCCAGG + Intronic
934985924 2:98884481-98884503 GTCAGGTGGCAGTGATGGGCAGG - Intronic
935578402 2:104734604-104734626 TGCATGTGGGAGTGCTGAGCAGG - Intergenic
935595830 2:104876836-104876858 AGCAAGTGGCAAAGCTGGCCTGG - Intergenic
937106173 2:119315445-119315467 GGCCTGTGGCATTGCTGGCTTGG - Intronic
937326123 2:120990326-120990348 GGCCTGTGGCTGTGGTGGCTGGG - Exonic
937419328 2:121741205-121741227 GGCCGGTGGCAGGGCTGGGCAGG + Intronic
938207498 2:129436832-129436854 GGTATGGGGCAGGGCTGGGCTGG - Intergenic
938621117 2:133054450-133054472 GGCATGTTGCAGTGCTAACAGGG - Intronic
939489506 2:142860278-142860300 GGCATTTTGCAGTGTTGCCCAGG + Intergenic
942606555 2:177697994-177698016 GGCATCTAGCAGTGGAGGCCAGG + Intronic
944792188 2:203142345-203142367 GGCATTTCGCCATGCTGGCCAGG + Intronic
945632857 2:212304422-212304444 GGCCTGTGTCTGGGCTGGCCTGG + Intronic
945715744 2:213355877-213355899 GGAAGTTGGCAGTTCTGGCCAGG - Intronic
946005023 2:216517568-216517590 GCCCTGTGGCAGTGCTGTCAGGG - Intronic
946057896 2:216917546-216917568 GGCTTTTGGCATTTCTGGCCTGG + Intergenic
948459975 2:238124327-238124349 GGCATGCGGCCCTGCTGGCTGGG + Intronic
1168754929 20:309897-309919 TGCAAGTGGCAGGGCTGGCGGGG + Intergenic
1172225397 20:33302161-33302183 GGCATGGGGTCCTGCTGGCCTGG - Intronic
1173763593 20:45586563-45586585 GGCTTGCGGCAGTGCAGCCCAGG + Intergenic
1174911950 20:54617215-54617237 AGTATGTGGCTGTGCTGGCAAGG - Intronic
1175332961 20:58177463-58177485 GGCATGTGACAGCGATGGCTGGG - Intergenic
1175804614 20:61820593-61820615 GGCAGGTGGAAGTTGTGGCCAGG + Intronic
1175918705 20:62439874-62439896 AGCATGTGGCACTGCTGTGCAGG - Intergenic
1176058075 20:63159483-63159505 GGCCTGTGACTATGCTGGCCGGG + Intergenic
1176842078 21:13849757-13849779 GGGATGGGACAGTGCTGCCCAGG - Intergenic
1179015043 21:37589089-37589111 GGCTTGTGGCAGTACAGCCCAGG + Intergenic
1179437108 21:41369588-41369610 AGCAGGTGGGAGTGCTGGGCTGG + Intronic
1179972926 21:44846190-44846212 TGCATGAGGAAGGGCTGGCCTGG - Intergenic
1181901136 22:26156669-26156691 TGCCTGTGACAGTGCTGGCTGGG - Intergenic
1182207849 22:28646671-28646693 GGCATTTTGCCATGCTGGCCAGG - Intronic
1182410053 22:30177354-30177376 GGCAAGGGGCAGTGCTGAACAGG - Intergenic
1182516219 22:30860604-30860626 GCCCTGTGGAAGTCCTGGCCTGG + Intronic
1183141284 22:35942694-35942716 GGGATGTCGCTGTGCTGCCCAGG - Intronic
1183394155 22:37561783-37561805 CGCAGGCCGCAGTGCTGGCCAGG - Intronic
1183964668 22:41434576-41434598 GGAGGCTGGCAGTGCTGGCCTGG + Exonic
1184264737 22:43341127-43341149 GGCAGGTGGCATTGCTTTCCGGG + Intronic
1184271838 22:43388788-43388810 GGCATGAGGCAGGGGAGGCCAGG + Intergenic
1184413561 22:44339340-44339362 GGCATGAGGCAGTGCGGTGCAGG + Intergenic
1184516717 22:44966646-44966668 GGCAGCTGGCAGGGTTGGCCTGG - Intronic
1184651055 22:45919661-45919683 GGCATGTGGCAGGGCCGGTTTGG - Intergenic
1184660004 22:45961345-45961367 GGCAAGTGGCAGGGGAGGCCCGG + Intronic
1184791470 22:46702930-46702952 GGGTGGCGGCAGTGCTGGCCGGG - Intronic
1184832272 22:46996337-46996359 GTCATCTCCCAGTGCTGGCCGGG + Intronic
952960721 3:38587613-38587635 GGCAGGTGCCCCTGCTGGCCAGG - Intronic
953339122 3:42118981-42119003 GGCATGTGTCTGTCCTGGACAGG + Intronic
953474148 3:43191861-43191883 TGCAGGGGGCTGTGCTGGCCAGG - Intergenic
953627264 3:44581113-44581135 GGCCTGTGGCAGGGCCGGCGAGG - Intronic
954681564 3:52348853-52348875 GGCATGTGGCAGGGCAGACCTGG - Intronic
954713204 3:52514947-52514969 GGCATCAGGCAGTCCAGGCCTGG - Intronic
954843834 3:53536583-53536605 GGCATAAGGCCGTGTTGGCCCGG - Intronic
955333536 3:58067082-58067104 GGCATGGGGGAGTCGTGGCCAGG - Intronic
958816847 3:98925658-98925680 GGCATGTCCCTGTGTTGGCCGGG + Intergenic
961058744 3:123810701-123810723 TGCCTGTGGCAGGACTGGCCGGG + Intronic
961402365 3:126656234-126656256 GGGAGGTCGCAGGGCTGGCCGGG + Intergenic
961740278 3:129029040-129029062 GGGCTGTGGCAGGGCTGGACTGG - Intronic
961881229 3:130062613-130062635 GGCTTGTGGCAGTACAGCCCAGG - Intergenic
964125271 3:153229052-153229074 GGCTTGTGGCAGTACAGCCCAGG + Intergenic
964221889 3:154356309-154356331 TGAATGTGGAAGTTCTGGCCAGG + Intronic
968017946 3:195356427-195356449 GGCAAGTTGTAGTGCTGGGCTGG + Intronic
968080557 3:195843560-195843582 GGCACGTGGAAGAGCTTGCCAGG - Intergenic
968235576 3:197028765-197028787 GGCCTCTGGCAGTGCTGGCTGGG - Intronic
968753551 4:2402831-2402853 GGGATGGGTCAGTGCTGCCCTGG - Intronic
969369738 4:6724077-6724099 GACATCAGGCAGAGCTGGCCAGG - Intergenic
969407530 4:7003808-7003830 GGGATTTGGCCGTGTTGGCCAGG - Intronic
970648915 4:18156382-18156404 GGAATGTGGCAATGATGGCAGGG + Intergenic
971304211 4:25466005-25466027 GGCAGATGGCAGTGGGGGCCAGG + Intergenic
973366518 4:49213437-49213459 GGGATGTGACGGTGCTGCCCAGG - Intergenic
974548946 4:63348621-63348643 GCCAAGTGGCAGAGCTGGGCTGG + Intergenic
976078230 4:81323273-81323295 GGTATTTGGAAGTTCTGGCCAGG + Intergenic
984437448 4:179723793-179723815 GGCTTGTGGCAGTACAGCCCAGG - Intergenic
985422785 4:189801351-189801373 TGCATGTGGCAGATGTGGCCTGG + Intergenic
985478984 5:95501-95523 AGCAACTGGCAGTGCTGCCCGGG - Intergenic
985525511 5:399473-399495 GGCAAATGGCTGTGCTGGACAGG - Intronic
985668885 5:1196289-1196311 GGCAATGGGCAGGGCTGGCCAGG + Intergenic
985708178 5:1413702-1413724 TCCATGTGGCAGAGCAGGCCGGG + Intronic
986264987 5:6183555-6183577 GGAGTGTGGCATTGCTGCCCGGG + Intergenic
991930646 5:71750167-71750189 GGCATAGGGCAGTGGTGGCATGG + Intergenic
992181619 5:74203392-74203414 AGCTTGTGGCCGTGGTGGCCAGG - Intergenic
992565445 5:77991264-77991286 GGCCTGTGCCAGTGCTGCCTCGG - Intergenic
995747977 5:115423780-115423802 GGCATGTCCCAGTGCTGACAGGG - Intergenic
997769503 5:136541975-136541997 GCCTTGTGGCAGTGCAGCCCAGG + Intergenic
998225131 5:140321142-140321164 GGCATGTGCCTGTGGTGTCCTGG - Intergenic
999139360 5:149347475-149347497 GGGCTGTGGCAGTCCTGACCTGG - Intronic
999481719 5:151954494-151954516 GTCATGTGGCAGTATTGGCGAGG - Intergenic
1000917064 5:167095351-167095373 GACATGGGGCAGGGCTGGCCTGG + Intergenic
1001515100 5:172350148-172350170 GTCAAGAGGCATTGCTGGCCGGG - Intronic
1001630659 5:173172839-173172861 AGAATGTGGCAGCTCTGGCCGGG - Intergenic
1001910599 5:175514193-175514215 GGCAAGAGGCAGTGATGGGCTGG + Intronic
1002037617 5:176484611-176484633 GGCATGAGCCACTGCTGGCCAGG - Intronic
1002575734 5:180172716-180172738 AGCAGGTGGCAGAGGTGGCCTGG - Intronic
1003026064 6:2556809-2556831 GGAATGTGGCAGTGCTTGTAGGG - Intergenic
1004872578 6:19922365-19922387 GGCACATGGCAGGCCTGGCCAGG - Intergenic
1004915099 6:20324537-20324559 GGCATGAGCCACTGCAGGCCTGG - Intergenic
1006101155 6:31687225-31687247 GGCATCTGGAAGTTCTGGGCTGG + Exonic
1006642725 6:35497128-35497150 CGCAGGGGGCGGTGCTGGCCGGG + Intergenic
1006872695 6:37266756-37266778 AGAATGAGGCAGTTCTGGCCAGG - Intronic
1007036418 6:38678521-38678543 GGGAGGTGGTAGTTCTGGCCTGG + Intronic
1007591205 6:43021790-43021812 GGCATGGGGCAGGGCGGGCTGGG + Intronic
1007686136 6:43668437-43668459 GGCAGGGGGCAGTGCTGCGCAGG - Intronic
1007718735 6:43872683-43872705 GCCATGTGGGAGAGCTGGCAGGG + Intergenic
1010456100 6:76057359-76057381 GGCATGTAGCAGTGGGGACCGGG + Intronic
1010963676 6:82177555-82177577 GGCATGTGCCACCCCTGGCCCGG + Intronic
1012446746 6:99314716-99314738 GGCATGAGGCAGTGGTGGCAGGG - Intronic
1014241133 6:119018720-119018742 GGCACGTGTCATTGCTTGCCTGG - Intronic
1015526162 6:134176501-134176523 GACGTGAGCCAGTGCTGGCCGGG + Intronic
1015897948 6:138035098-138035120 GGCATCAGGGAGGGCTGGCCAGG - Intergenic
1017861001 6:158397183-158397205 GGCAAGGGTCAGTCCTGGCCAGG + Intronic
1018568593 6:165183883-165183905 CACATGGGGCAGGGCTGGCCTGG - Intergenic
1019657339 7:2202929-2202951 GGCACCTGTCAGTGCTGACCTGG - Intronic
1019907123 7:4073207-4073229 GGGCTCAGGCAGTGCTGGCCAGG - Intronic
1020112578 7:5455873-5455895 CGCATGGGGCAGAGATGGCCAGG - Intronic
1020128595 7:5546874-5546896 GGCATTGGGCAGAGATGGCCAGG - Intronic
1020198261 7:6059120-6059142 GGAGTGTGGCAGTGCTGGGCTGG - Exonic
1020821286 7:12971510-12971532 GGAAAGTGGCAGAGCAGGCCAGG + Intergenic
1021027477 7:15686856-15686878 GGCAGCCGGCAGTGCTGGGCGGG - Intergenic
1022414633 7:30167569-30167591 TGCATCTGGGAGAGCTGGCCCGG + Intergenic
1022467558 7:30661848-30661870 TGGATGTGGCAGCTCTGGCCCGG - Intronic
1025150216 7:56541515-56541537 GAGATGGGCCAGTGCTGGCCAGG + Intergenic
1026343154 7:69451487-69451509 GGCATCTGGCTATGCTGCCCAGG - Intergenic
1027501247 7:78954199-78954221 GACATTTGGCAGTGCTCTCCGGG - Intronic
1027996205 7:85427797-85427819 GGCAAGTTCCAGTGCTGTCCTGG + Intergenic
1029393803 7:100293225-100293247 GGCATTTCGCCGTGTTGGCCAGG - Intergenic
1029733619 7:102453578-102453600 GGCTTGTGGGCTTGCTGGCCTGG - Exonic
1030252514 7:107463312-107463334 GGCAGGTGGCACTGCTGTACTGG + Intronic
1031511256 7:122653073-122653095 GTCATGTGGCAGCCCTGGCAAGG + Intronic
1032279071 7:130486541-130486563 GGCGTGAGGCTGTGCTGGCGAGG + Intronic
1034542796 7:151769768-151769790 GGCAGGTGGCACTGCTTGCGGGG + Intronic
1035585295 8:768197-768219 AGCATGTGGCAGTGCCTCCCCGG - Intergenic
1036549858 8:9806287-9806309 GGCTTGTGGCAGTACAGCCCAGG - Intergenic
1036943600 8:13073699-13073721 GGGATCTGGCTATGCTGGCCAGG - Intergenic
1037445973 8:18966376-18966398 GGGATTTCGCAGTGTTGGCCAGG - Intronic
1037601167 8:20395340-20395362 GCCAGCTGGCAGGGCTGGCCTGG + Intergenic
1037993782 8:23338789-23338811 GGGTTGTGGCAGGACTGGCCTGG - Intronic
1038444679 8:27595079-27595101 GGCATCTCTCAGTGTTGGCCGGG - Intergenic
1039697187 8:39925586-39925608 AGAAAGTGGCAGAGCTGGCCAGG + Intronic
1043280144 8:78453824-78453846 GCCATGTGGGAGAGCTAGCCAGG - Intergenic
1047677448 8:127218817-127218839 GGTAAGTGGCAGGGCTGGCCAGG + Intergenic
1048209804 8:132445353-132445375 GCCACGTGGCTGTGCTGCCCTGG - Intronic
1048826291 8:138430654-138430676 GCCAGGTGGCAGAGTTGGCCTGG + Intronic
1049347744 8:142147770-142147792 GGCATGAGGTGGTGCTGGCAGGG - Intergenic
1049353949 8:142178571-142178593 GGCAAGTGGCAGAGCTGGGGTGG - Intergenic
1049615505 8:143574142-143574164 TGCACGTGGCTGTGCTGGGCTGG - Intergenic
1049709870 8:144058652-144058674 AGCAGGTGGGTGTGCTGGCCCGG - Exonic
1051306767 9:15718210-15718232 GGCCTGTGGCAGTGGTGGCCAGG + Intronic
1052476913 9:28971747-28971769 GGCAGGTGGCAAAGGTGGCCAGG - Intergenic
1052975721 9:34408480-34408502 GAAATGTGCCAGTGCTGCCCTGG - Intronic
1053390569 9:37732489-37732511 GGCATCTGGCCCTCCTGGCCAGG - Intronic
1055583651 9:77733468-77733490 GTCATGTGGCAGTGGTGACATGG - Intronic
1056363888 9:85884043-85884065 GGCTTGTGGCAGTACAGCCCAGG - Intergenic
1056679524 9:88704986-88705008 TGCATGTGGCAGTGCTGAGAAGG + Intergenic
1056756863 9:89387128-89387150 GGCCTGTGGCTGGGCTGGGCTGG - Intronic
1057502255 9:95605056-95605078 GGCATGTGGCTGTGGTGGCCGGG + Intergenic
1057593341 9:96392891-96392913 GGCATTTTGCCGTGTTGGCCAGG - Intronic
1057721939 9:97538977-97538999 GGAGTCTGGCTGTGCTGGCCAGG - Intronic
1061378784 9:130241850-130241872 GGAAGGTGCAAGTGCTGGCCTGG + Intergenic
1061760316 9:132846803-132846825 GGGAAGCGGCAGGGCTGGCCAGG - Intronic
1061789899 9:133053687-133053709 TGCATGTGGCAGAGCAGGGCTGG + Intronic
1061987995 9:134141363-134141385 GGCATGTGGCCGTGCTGAATGGG + Intronic
1062283964 9:135764912-135764934 GGCCTGGGGCAGGGCCGGCCGGG - Intronic
1187132625 X:16517418-16517440 GGCAAGTTCCAGTGCTGGACTGG + Intergenic
1187410355 X:19045686-19045708 GGTATGAGGCAGTGACGGCCTGG - Intronic
1188118630 X:26277530-26277552 GGCAAGTCCCAGTGCTGGGCTGG - Intergenic
1188212321 X:27441038-27441060 GCCATTTGACAGTGATGGCCCGG - Intergenic
1188725799 X:33580422-33580444 GGCATGTCCCAGTGCTGCACAGG - Intergenic
1189257416 X:39651213-39651235 TGCAGGCGGCCGTGCTGGCCAGG - Intergenic
1189380647 X:40500170-40500192 GGGAGGTGAGAGTGCTGGCCAGG - Intergenic
1190808434 X:53861417-53861439 GGCATGTCCCAGTGCTGTGCTGG - Intergenic
1191715650 X:64191974-64191996 AGCATGTAGCCGTGGTGGCCTGG + Exonic
1192231670 X:69269522-69269544 GAGAGGTGGCAGTGCTGGCTGGG + Intergenic
1192490986 X:71577492-71577514 AGAAAGTGGCAGAGCTGGCCGGG - Intergenic
1192522255 X:71813272-71813294 GGCATGTGGGTGTGCTGGTTTGG + Intergenic
1192773950 X:74222545-74222567 TGCATCTGGCTGTGTTGGCCAGG - Intergenic
1194257583 X:91653237-91653259 GGCATGTCCTAGTGCTGGTCTGG - Intergenic
1195697551 X:107678086-107678108 CGAAGGTGGCAGTGCTGGGCTGG + Intergenic
1197768035 X:130071593-130071615 GCCATGTTGCAGTGCTACCCTGG - Intronic
1198305933 X:135383094-135383116 GGAATGTGGGAGTGCTGCTCAGG - Intergenic
1198896042 X:141455608-141455630 AGTACGTGGCAGTGCTGGTCGGG + Intergenic
1200091508 X:153638262-153638284 GGCAAGTGGCAGCGGTGGGCAGG + Intergenic
1200576240 Y:4892183-4892205 GGCATGTCCTAGTGCTGGTCTGG - Intergenic
1201268584 Y:12232349-12232371 GGTATGTGGAAGTGCTGGTGTGG + Intergenic
1201399559 Y:13590460-13590482 GGGATTTTGCAATGCTGGCCAGG - Intergenic