ID: 901361355

View in Genome Browser
Species Human (GRCh38)
Location 1:8703383-8703405
Sequence TCACCGGCATGTGGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361355_901361364 20 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361355_901361358 -10 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361358 1:8703396-8703418 ATGCCGGTGACCCAGACGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 64
901361355_901361363 17 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361355_901361365 23 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361355_901361366 27 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361355 Original CRISPR TCACCGGCATGTGGCAGTGC TGG (reversed) Intronic
900107544 1:990615-990637 TCACGGGCATGTGGATGTTCGGG + Intergenic
901361355 1:8703383-8703405 TCACCGGCATGTGGCAGTGCTGG - Intronic
901367648 1:8767150-8767172 TCACTGGCATGTAGCATTACTGG + Intronic
901489628 1:9589929-9589951 TCAGCAGCAAGTGGCAGAGCTGG + Intronic
902584383 1:17429359-17429381 TCATCGGCAAGTGGCAATGCGGG + Intronic
903275503 1:22218842-22218864 TGTCCGGCAGGTGGAAGTGCTGG + Intergenic
905279937 1:36842619-36842641 TCATCGGTAGGTGGCTGTGCCGG + Intronic
905308200 1:37033346-37033368 TCTCCCGCCTGGGGCAGTGCAGG - Intronic
906047297 1:42841730-42841752 TAACTAGCATGTGGCAGAGCTGG + Intronic
906796075 1:48697276-48697298 TCACCAGCAGGTGGCAGCACGGG - Intronic
919390631 1:196980418-196980440 TCACATGTTTGTGGCAGTGCTGG - Intronic
1063494416 10:6493764-6493786 TCACCTGTACGTGGCAGAGCTGG - Intronic
1065744998 10:28832278-28832300 TCAGCGGCAGGTGTCAGTGCTGG - Intergenic
1069636929 10:69930547-69930569 TCACCGGTGAGTGGCAGGGCTGG + Exonic
1070954971 10:80457732-80457754 TCTTCTGCATGTGGTAGTGCTGG - Intronic
1074242920 10:111656998-111657020 TTACCTGCATGTGGCAGTGCAGG + Intergenic
1076606326 10:131691984-131692006 GCCCAGGCATGTGGAAGTGCAGG - Intergenic
1076722598 10:132399210-132399232 TCCCCTGCATGTGACAGTGGAGG + Intronic
1083858084 11:65403823-65403845 TCAGAGGCATGTTGCTGTGCAGG + Intronic
1084226327 11:67716629-67716651 TCAGAGGCCTGTGCCAGTGCAGG - Intergenic
1088088952 11:106014819-106014841 TCAGCAGCAAGTGGCAGTTCAGG - Intronic
1088158295 11:106836861-106836883 TCAACTGCAAGTGGTAGTGCCGG + Intronic
1092118326 12:6025576-6025598 TCACCAGCTTGTTGCAGTCCTGG + Exonic
1096524646 12:52203363-52203385 TCACAGGGATGAGGCAATGCTGG - Intergenic
1105337018 13:19481843-19481865 TCACCAGCTTGTGTCAATGCTGG - Intronic
1105723917 13:23142310-23142332 GCACGGGCAGGTGGCAGTGCTGG - Intergenic
1106489190 13:30201466-30201488 TCATCAGCATGTGGTAGTGTCGG - Intergenic
1108178665 13:47819864-47819886 TCACATGGCTGTGGCAGTGCTGG - Intergenic
1112264593 13:97911720-97911742 TTACCTGCAGGTGGCACTGCAGG - Intergenic
1113504157 13:110801695-110801717 TCACTGCCATGTGGATGTGCAGG + Intergenic
1113564203 13:111308815-111308837 TAACTAGGATGTGGCAGTGCTGG - Intergenic
1113879392 13:113615271-113615293 TCACCAGCATTTGGTAGTGGTGG + Intronic
1115784374 14:36807522-36807544 TCACCCTCATGTGGAAGTGTGGG - Intronic
1116549997 14:46225083-46225105 TCACCTGTTTGTGGCAATGCAGG + Intergenic
1122266186 14:100547942-100547964 TAAACCGCATGTGGCACTGCGGG + Intronic
1128095947 15:64955639-64955661 TCTCCTTCATGTGGCAGAGCTGG + Intronic
1130319946 15:82833275-82833297 TCTCCGGAAGGTGGAAGTGCCGG + Exonic
1131403171 15:92142714-92142736 TCACCCGGATGGGGCTGTGCAGG + Intronic
1132336736 15:101052766-101052788 TCACCCACAAGTGGCAGGGCCGG + Intronic
1132752972 16:1467331-1467353 CCACTGGCATGTGGCAAGGCTGG - Intronic
1132798730 16:1741128-1741150 TCACCAGCCTGTGTCAGAGCCGG + Intronic
1141429752 16:83965485-83965507 TCACCGGGATGTTGTAGTGGCGG - Exonic
1143724832 17:8837747-8837769 TGACCTGCATGTGGCTGGGCTGG - Intronic
1146576152 17:33993435-33993457 TAACAGCCATGTGGCTGTGCAGG - Intronic
1150220488 17:63493316-63493338 TCCCCTGCATGCTGCAGTGCTGG + Intronic
1150226420 17:63527052-63527074 TCCCGGGCAGGTGCCAGTGCGGG - Intronic
1152888727 17:82867860-82867882 TCACCGGCAGGAGGCACTGAGGG - Intronic
1153664763 18:7358975-7358997 TCACCAGCATGCAGCAGAGCTGG - Intergenic
1153914581 18:9734220-9734242 TCACAGGGCTGTGACAGTGCAGG - Intronic
1159074701 18:63667175-63667197 TCATGGGAATGTGGCTGTGCTGG + Intronic
1160758296 19:769843-769865 TCAGGGGCATGTGGCAGAGCTGG - Intergenic
1161706300 19:5823706-5823728 TTCCCGGCAGGTGGCAGTGTGGG - Intergenic
1162981021 19:14239912-14239934 TCCCAGGCTGGTGGCAGTGCAGG - Intergenic
1164212698 19:23114170-23114192 TCACCATCATGTTGCTGTGCTGG + Intronic
1165049551 19:33132655-33132677 TCCCCAGCAGGTGGCAGTGCGGG - Intronic
1165386688 19:35514145-35514167 TCACCTGTAGGTGGCAATGCGGG - Intergenic
1166007968 19:39920046-39920068 TCACCTGAACCTGGCAGTGCTGG + Intronic
1166759291 19:45214401-45214423 ACACCACCATGTGACAGTGCTGG - Intronic
1167220217 19:48194492-48194514 TGACCGGCAGGAGGCAGTGCAGG - Intronic
925476945 2:4227820-4227842 TGACCGGCATCTCGCAGGGCTGG + Intergenic
926161802 2:10494824-10494846 TGACCGGCATGTGGCAGGCACGG - Intergenic
932436286 2:71704169-71704191 TCCCCGCCGTGTGGCTGTGCGGG - Intergenic
932612842 2:73212660-73212682 TCACCACCAGGTGGCAGGGCAGG - Intergenic
933369094 2:81392412-81392434 CCTCCAGCATGTGGCTGTGCTGG - Intergenic
936991351 2:118369909-118369931 TCACCAGCATTTGGTGGTGCTGG - Intergenic
937991145 2:127663254-127663276 TCACCTGAGTGTGGCAGAGCTGG - Intronic
942489632 2:176476455-176476477 TCACCAGCATCTGGCCATGCTGG + Intergenic
945803684 2:214464910-214464932 TCACAGGCTTGGGGCAGTGGTGG - Intronic
947841694 2:233211880-233211902 TCAGTGGCAGGTGGCAGGGCTGG - Intronic
948524228 2:238560369-238560391 TCTCCTGGAGGTGGCAGTGCAGG - Intergenic
948844175 2:240675331-240675353 ACACCGGGGTGTGGCCGTGCTGG + Intergenic
948849685 2:240699548-240699570 ACACCGGGGTGTGGCCGTGCTGG - Intergenic
1172885785 20:38229944-38229966 TGACCAGCAGGTGGCAGTGATGG + Intronic
1173162146 20:40661029-40661051 TCACTGGGATGTGGGAGTGAGGG + Intergenic
1174686964 20:52465404-52465426 TCACCAGAATCTGGCAATGCTGG - Intergenic
1176736542 21:10553340-10553362 TCACCAGCTTGTGTCAATGCTGG + Intronic
1178116016 21:29417509-29417531 TCTCTGGGATGTAGCAGTGCTGG + Intronic
1178661326 21:34510139-34510161 TCACGCGGAAGTGGCAGTGCTGG + Intergenic
1179256020 21:39715977-39715999 TAACCGCCAGGTGGCACTGCAGG - Intergenic
1180569758 22:16703989-16704011 TCACCAGCTTGTTGCAGTCCTGG + Intergenic
1181602455 22:23960535-23960557 GCCCCGGAATGTGGCAGGGCAGG - Intronic
1181606058 22:23980772-23980794 GCCCCGGAATGTGGCAGGGCAGG + Intronic
1181964233 22:26645454-26645476 TTACCACCAGGTGGCAGTGCGGG - Intergenic
1182620128 22:31614331-31614353 TCATCAGCATGGGGCAGGGCAGG - Intronic
1183230690 22:36580176-36580198 TCACCGGGAAGTGGCAGAGCTGG + Intronic
1183300751 22:37057951-37057973 TCCCCTGCATGTTGCAATGCTGG - Intronic
1183394158 22:37561788-37561810 TCACCCGCAGGCCGCAGTGCTGG - Intronic
1183532594 22:38369345-38369367 TCACCAGCTTGTGTCAATGCTGG - Intronic
1184651056 22:45919666-45919688 CCAGAGGCATGTGGCAGGGCCGG - Intergenic
949144269 3:677305-677327 TCAGCGGCATCTGGTAGTACAGG + Intergenic
950102634 3:10367315-10367337 TCACCACCAAGTGGCAGAGCTGG - Intronic
950693397 3:14678735-14678757 TTTCTGGCATGTAGCAGTGCTGG + Intronic
950788381 3:15453881-15453903 TCACCGGCATGAGGGTGTGGAGG - Exonic
953220997 3:40971431-40971453 TCACCGGCAAGGGGCAGCACAGG - Intergenic
954596634 3:51830632-51830654 GCATCCGCATGTGGCAGTGCCGG + Exonic
955402584 3:58603795-58603817 TAACAGGCATGTGGGTGTGCTGG + Intronic
956100142 3:65759710-65759732 TCAACGTCATGGGGCAATGCTGG + Intronic
957785519 3:84877283-84877305 TCACAGGTATGTGGCACTTCTGG - Intergenic
959904880 3:111700159-111700181 TCACTGGGAGGTGGCAGAGCAGG - Intronic
960810252 3:121621489-121621511 CCACAGGAATGTGGCAGTGGCGG - Exonic
960981432 3:123231289-123231311 TCACTGGCATATGGTGGTGCAGG - Intronic
961700802 3:128743174-128743196 CCACCGGCCTGGGGCAGTGAGGG - Intronic
961957688 3:130821074-130821096 TCACTGCTATGTGGCAGAGCAGG - Intergenic
962776938 3:138670104-138670126 GCACCCACATGTGGGAGTGCTGG - Intronic
967981806 3:195070241-195070263 ACACCAGCAAGTGGCAGAGCTGG + Intronic
968235578 3:197028770-197028792 GCACAGGCCTCTGGCAGTGCTGG - Intronic
968257105 3:197285726-197285748 TCACCAGCATTTGGTAGTGTTGG - Intronic
968838159 4:2980686-2980708 TCACGGGTATGTGGCACTGACGG - Intronic
969023011 4:4150651-4150673 TCAGAGGCCTGTGCCAGTGCAGG - Intergenic
969427065 4:7130557-7130579 TCTCCAGCATGGGGCCGTGCAGG - Intergenic
969687244 4:8682532-8682554 TGGCTGGCATGTGGCAGAGCTGG - Intergenic
970783511 4:19768042-19768064 TCACAGGGATGTGGAAATGCAGG + Intergenic
972021675 4:34323481-34323503 GTACGGGCATGTGGCAGTGGTGG + Intergenic
972780661 4:42284323-42284345 TCTCCAACATGTGGCTGTGCTGG + Intergenic
984977801 4:185245090-185245112 TCCAAGTCATGTGGCAGTGCTGG + Intronic
985636571 5:1038584-1038606 TCACCGCCATGTGGCATCGAGGG - Exonic
996702466 5:126464211-126464233 TCACCTGCATATGACTGTGCAGG - Intronic
998554706 5:143112042-143112064 GCACTGGCGTGTGGCAGTGAGGG + Intronic
999257588 5:150218319-150218341 TCACCAGCAGGTGGCAGCACAGG - Intronic
1001419723 5:171577487-171577509 TGACCGGTATGTGGCAGAGTGGG - Intergenic
1001958856 5:175867713-175867735 TCATCAGCGTGTGGCAGGGCAGG - Intronic
1002107971 5:176889511-176889533 GGCACGGCATGTGGCAGTGCTGG - Exonic
1002424872 5:179169018-179169040 TCCCAGGCATGAGCCAGTGCAGG + Intronic
1002933579 6:1651941-1651963 TCCCCAGCACGTGCCAGTGCAGG - Intronic
1007653607 6:43438627-43438649 GCGTGGGCATGTGGCAGTGCGGG + Exonic
1013167160 6:107604674-107604696 TCACAGGCATATTGCAGTGAAGG - Intronic
1017711480 6:157172573-157172595 TCATGGGCACGTGGCAGGGCAGG + Intronic
1018342733 6:162868592-162868614 TCACCTGCATGGGGCGGGGCTGG - Intronic
1020198263 7:6059125-6059147 GCATCGGAGTGTGGCAGTGCTGG - Exonic
1020310063 7:6860376-6860398 TCAGAGGCCTGTGCCAGTGCAGG - Intergenic
1020313004 7:6883516-6883538 TCAGAGGCCTGTGCCAGTGCAGG - Intergenic
1024526779 7:50355885-50355907 TCACAGGCATGTGGCAGGAGGGG - Intronic
1026420770 7:70234878-70234900 TCACCGTCCTATGGCAGGGCAGG + Intronic
1030703683 7:112668772-112668794 TCACAGGAATGGGGCAGAGCAGG + Intergenic
1035189039 7:157149535-157149557 TCTCAGGGATGTGCCAGTGCAGG - Intronic
1036902203 8:12678549-12678571 TCAGAGGCAAGTGCCAGTGCAGG - Intergenic
1038606983 8:29016881-29016903 CCAACAGCATGTGGCAGTGATGG - Intronic
1040574280 8:48637428-48637450 TCACCTGGCTGTGGTAGTGCTGG + Intergenic
1045065628 8:98441492-98441514 TGACTGGCAAGTGGCAGAGCTGG + Intronic
1049733778 8:144192584-144192606 TCACCTGCATGTGCCACTACTGG - Intronic
1050132530 9:2427500-2427522 TCACAGGTATGTGGCATTGTGGG - Intergenic
1052863330 9:33450193-33450215 TTACAGGCATGTGGCAGAGGTGG - Intergenic
1054929237 9:70618897-70618919 TCACCGACATGTGGATGGGCCGG - Exonic
1060429950 9:123542474-123542496 TCTCTGGGATCTGGCAGTGCTGG + Intronic
1061858347 9:133455374-133455396 TCACCGGCTTGGGCAAGTGCTGG - Exonic
1194393192 X:93346572-93346594 CCACCCGCCTGTGGCAGAGCTGG + Intergenic
1199720073 X:150537069-150537091 TCTCGGGCCTGTGGCAGTGAGGG - Intergenic