ID: 901361355

View in Genome Browser
Species Human (GRCh38)
Location 1:8703383-8703405
Sequence TCACCGGCATGTGGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361355_901361365 23 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361355_901361363 17 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361355_901361364 20 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361355_901361358 -10 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361358 1:8703396-8703418 ATGCCGGTGACCCAGACGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 64
901361355_901361366 27 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361355 Original CRISPR TCACCGGCATGTGGCAGTGC TGG (reversed) Intronic