ID: 901361359

View in Genome Browser
Species Human (GRCh38)
Location 1:8703399-8703421
Sequence TCTCCCGGCGTCTGGGTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361359_901361363 1 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361359_901361366 11 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361359_901361364 4 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361359_901361371 22 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361371 1:8703444-8703466 GGCGGCGGCCGGCAAAACCCGGG 0: 1
1: 0
2: 1
3: 5
4: 87
901361359_901361370 21 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361370 1:8703443-8703465 CGGCGGCGGCCGGCAAAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 62
901361359_901361365 7 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361359_901361372 26 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361359 Original CRISPR TCTCCCGGCGTCTGGGTCAC CGG (reversed) Intronic
900118134 1:1037198-1037220 GCTCCAGGCCTCTGGCTCACAGG - Intronic
901361359 1:8703399-8703421 TCTCCCGGCGTCTGGGTCACCGG - Intronic
901922965 1:12549119-12549141 TCTCCCGGCGCCCGGGCCCCAGG - Intergenic
903225640 1:21893013-21893035 TCTCCCGGCCTCTGGCTCCAAGG - Intronic
906320762 1:44813882-44813904 TCTTCCGGCGCCCGGCTCACTGG - Exonic
908246156 1:62229010-62229032 TCTCCCCCAGCCTGGGTCACTGG + Intergenic
912712207 1:111958100-111958122 TCTCCAGGCTGCTAGGTCACTGG - Intronic
914674767 1:149900029-149900051 ACTCCTGGCGTCTGAGTCTCTGG + Exonic
917277577 1:173347143-173347165 TCTCCCAGAGTCTGGGAGACAGG + Intergenic
1063377082 10:5560895-5560917 TCTCCAGACGACTGGGTCCCTGG - Intergenic
1065188589 10:23191886-23191908 GCTCTCGCCGTCTGGGCCACCGG + Intergenic
1066483612 10:35822626-35822648 TCTCCCAGCGTCTGTGTGTCGGG - Intergenic
1072811811 10:98467979-98468001 TCTCCCGGGCTCCGGGTCCCCGG + Intronic
1073450901 10:103608235-103608257 TCTCCCGGCTTCCGGGACTCCGG - Intronic
1074591819 10:114821572-114821594 TCTCAGGGCGCCTGGGACACCGG - Intergenic
1075716815 10:124560636-124560658 GCTCCCGACGTCAGGCTCACAGG + Intronic
1079035275 11:17014671-17014693 TCTCCCGGCCTCGGGGGCAAAGG - Intergenic
1086398627 11:86442676-86442698 TCACCCAGCCTCTGGGTTACAGG + Intronic
1088877802 11:113950334-113950356 TCTCCTGGGGGCTGTGTCACTGG + Intergenic
1093762393 12:22924894-22924916 TCTCCTGGGGGCTGTGTCACAGG + Intergenic
1096784012 12:54006891-54006913 GCTCCCAGCATCTGGGTCACTGG - Intronic
1098301333 12:69056916-69056938 TCTCCCAACGTCTGGGAAACTGG - Intergenic
1100407734 12:94285771-94285793 TCTCCCTGTGTCTGGGTGGCAGG + Intronic
1101163509 12:102004751-102004773 TCTCCTGAAGTCTGTGTCACAGG + Intronic
1101504363 12:105331973-105331995 TTTACCGGCGTCTGGGTTAAGGG - Intronic
1102236829 12:111298866-111298888 ACTCCCGCAGTCTGGGTCAGCGG - Intronic
1102910586 12:116710774-116710796 TATCCCAGCGGCTGGGTCCCAGG - Exonic
1105837556 13:24224260-24224282 GCTGCCAGCGTTTGGGTCACAGG - Exonic
1112869638 13:103954091-103954113 TCTCCCGGTGTCAAGGCCACTGG + Intergenic
1121720402 14:96105026-96105048 TCACCCTGGGGCTGGGTCACTGG - Intergenic
1122695285 14:103549397-103549419 TCTTCCCGCCTCTGGGTCCCAGG - Intergenic
1128724980 15:69981876-69981898 TCTGCAGGTGTCTGGGCCACTGG + Intergenic
1132507545 16:319103-319125 TCTCCCAGCCTCTGTGTCCCCGG - Intronic
1132917497 16:2359770-2359792 TCTCCCTGCTCCTGTGTCACAGG - Intergenic
1136672741 16:31873184-31873206 TCTCCTGGAGTCTGCATCACTGG - Intergenic
1137938226 16:52656083-52656105 TCAGGCGGAGTCTGGGTCACAGG - Intergenic
1138677356 16:58661327-58661349 ACTCCAGGCCTCTGAGTCACTGG - Intergenic
1142217657 16:88837750-88837772 TTTCCAGGCATCTGGGTCACAGG - Exonic
1142257580 16:89022172-89022194 TCTGCCCTCGCCTGGGTCACAGG - Intergenic
1144758593 17:17694699-17694721 CCTCCCGGCGTCGGCGTCGCGGG - Intronic
1160831050 19:1104984-1105006 TCTCCCGGCCTCCGGGTCTCCGG + Intronic
1163263703 19:16206049-16206071 TGTCCCGGCGGCTGGGTGAAGGG - Intronic
1165916383 19:39263585-39263607 TCTCCTGGGGGCTGTGTCACAGG + Intergenic
1166695099 19:44847613-44847635 TCTCCCAGCCTCTGGGACTCGGG - Intronic
1168686718 19:58353375-58353397 CCTCCTGGGGTCTGGGTCCCTGG - Intronic
926792842 2:16592538-16592560 TGTCTGGGCATCTGGGTCACTGG + Intronic
929111103 2:38405829-38405851 CCTCCTGGGGTCTGTGTCACGGG + Intergenic
929777790 2:44939311-44939333 CCGCCCGGCGCCTGGGTCCCCGG + Intergenic
933705805 2:85289341-85289363 TCTCCTGGTCTCTGGGTCTCTGG - Intronic
933829405 2:86195024-86195046 GCTGCTGGCGTCTGGGTCGCCGG - Intronic
939885937 2:147681906-147681928 TCTCCCTGGGCCTGGGTCTCCGG - Intergenic
942347658 2:175019888-175019910 TCTCCTGGCATCTGGGGCAGTGG - Intergenic
946692692 2:222320570-222320592 TCGCCCGGGGGCTGGGTCCCTGG + Intergenic
947541851 2:230985377-230985399 TCTCCCTGTGAGTGGGTCACAGG + Intergenic
947873894 2:233455628-233455650 TCTCCCAGCTTCTGGGTCAAGGG - Intronic
948551775 2:238777822-238777844 TCTCTGGGCCTCTGGGTCTCTGG - Intergenic
1174350988 20:49967885-49967907 CCTCCCAGGGTCAGGGTCACAGG + Intergenic
1176217956 20:63957098-63957120 CCTCCCGGGGTCAGGCTCACTGG + Exonic
1176314873 21:5232771-5232793 TCTCCTGGCGTCTGGTTTTCGGG - Intergenic
1181236546 22:21450715-21450737 ACTCCTGGCGTCTGATTCACAGG - Exonic
1181638697 22:24185941-24185963 TTTCCCAGGGTCTGGGGCACGGG - Intronic
1183310031 22:37104576-37104598 TCTCCCGGTGGGTGGGTCAAAGG - Intronic
1185393820 22:50576957-50576979 TCCACGGGCGTCTGGGTGACGGG - Exonic
950442928 3:13020238-13020260 TATCCCGGGGTCTGGGGCAGGGG + Intronic
951611274 3:24494897-24494919 CCTCCCGGCGGCGGGGTCCCGGG + Intronic
952964209 3:38611018-38611040 CCTCCCTGCCTGTGGGTCACAGG - Intronic
955787373 3:62554691-62554713 TCTCCCTACTTCTGGTTCACAGG + Intronic
957297670 3:78353722-78353744 TCTCCCGAGGGCTGTGTCACGGG + Intergenic
961326591 3:126112741-126112763 TCTGCGGGCGGCTGGTTCACTGG - Intronic
969537640 4:7766541-7766563 TCTCCAGGTGACTGTGTCACGGG + Intronic
969537646 4:7766576-7766598 TCTCCAGGTGACTGTGTCACGGG + Intronic
969633303 4:8351021-8351043 TCCCCTGGCGTCAGGGTCACAGG - Intergenic
971556495 4:28018866-28018888 TCTCCCGGAGTCTTAGTGACTGG + Intergenic
981511313 4:145561749-145561771 CCTCCCGGCCTCAGGGTGACTGG + Intergenic
985672457 5:1213591-1213613 TCTCCCGGGGTCTGGGCCCAGGG - Intronic
987311139 5:16682097-16682119 CTTCCTGGCTTCTGGGTCACGGG + Intronic
988517032 5:31913991-31914013 ACTCCCTGCCTCTGGGTGACAGG + Intronic
995809059 5:116084909-116084931 TCTCCCGGCGCCCGGGTCGCAGG + Intergenic
1001273389 5:170332354-170332376 TCTCCTGAGGTCTGTGTCACGGG - Intergenic
1002787762 6:417413-417435 TCTCCAAGCAGCTGGGTCACTGG + Intergenic
1019415112 7:923519-923541 GGTCCCGGCCTCTGAGTCACAGG + Intronic
1020198311 7:6059325-6059347 TCTACCGGCGGCTGGGTTTCAGG + Intergenic
1020256987 7:6508066-6508088 TGTCCCGGGGCCTGGGCCACCGG - Exonic
1023472923 7:40544396-40544418 TCTTCCTTCGTCTGGGTCAGAGG - Intronic
1024340032 7:48247937-48247959 TCTCAGGGGGTCTGGTTCACAGG + Intronic
1026743186 7:72991419-72991441 TCTCCCGGGGACTGGGTGTCGGG + Intergenic
1027029300 7:74876116-74876138 TCTCCCGGGGACTGGGTGTCGGG + Intergenic
1027100549 7:75373659-75373681 TCTCCCGGGGACTGGGTGTCGGG - Intergenic
1034182247 7:149147799-149147821 TCCCTCGGGGTCTGGGTCTCGGG - Intronic
1044634031 8:94304564-94304586 TCACCCGTTGTCTGGGTCAGAGG - Intergenic
1046949303 8:120004635-120004657 TCTCCTTGCCTCTGGGTCAAAGG + Intronic
1048875968 8:138837360-138837382 TCTCCCAATGTCTGGGTGACTGG - Intronic
1048964755 8:139607548-139607570 TGTCCAGGCATCTGGTTCACTGG + Intronic
1049454360 8:142679482-142679504 TCTCCTGGGGGCTGTGTCACAGG - Intronic
1049858496 8:144880434-144880456 TCTCACGGTTTCTGGGGCACAGG + Exonic
1058638911 9:107064175-107064197 TCTCCTGAGGGCTGGGTCACAGG + Intergenic
1060051629 9:120382546-120382568 GCTGCCTGCGGCTGGGTCACTGG + Intergenic
1062381328 9:136288253-136288275 TTCCCGGGAGTCTGGGTCACAGG - Intronic
1062482898 9:136760625-136760647 TCTCCCGGCGTCTGGTTTAGGGG + Intronic
1185805004 X:3049093-3049115 TCTCCTGAAGTCTGCGTCACGGG - Intronic
1187547724 X:20268415-20268437 TCTCCAGGTGTCTGGGTCCCGGG - Intergenic
1188285983 X:28326139-28326161 CCTCCTGAGGTCTGGGTCACAGG - Intergenic
1189750255 X:44213383-44213405 TCTCCTGGGGGCTGTGTCACGGG - Intronic
1198258516 X:134946019-134946041 TCTCCTGGGGGCTGTGTCACAGG + Intergenic
1199608158 X:149592974-149592996 TCGCCGGCCGGCTGGGTCACTGG + Exonic
1199630962 X:149776386-149776408 TCGCCGGCCGGCTGGGTCACTGG - Exonic
1200308798 X:155056627-155056649 TCTCCTGACATCTGGGTCTCTGG + Exonic
1202254265 Y:22904626-22904648 TCTCCCTGTGGCTGGGGCACAGG + Intergenic
1202407256 Y:24538375-24538397 TCTCCCTGTGGCTGGGGCACAGG + Intergenic
1202463526 Y:25131706-25131728 TCTCCCTGTGGCTGGGGCACAGG - Intergenic