ID: 901361360

View in Genome Browser
Species Human (GRCh38)
Location 1:8703406-8703428
Sequence CTCTTTCTCTCCCGGCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361360_901361372 19 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361360_901361365 0 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361360_901361363 -6 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361360_901361364 -3 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361360_901361371 15 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361371 1:8703444-8703466 GGCGGCGGCCGGCAAAACCCGGG 0: 1
1: 0
2: 1
3: 5
4: 87
901361360_901361366 4 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361360_901361370 14 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361370 1:8703443-8703465 CGGCGGCGGCCGGCAAAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361360 Original CRISPR CTCTTTCTCTCCCGGCGTCT GGG (reversed) Intronic
901361360 1:8703406-8703428 CTCTTTCTCTCCCGGCGTCTGGG - Intronic
904468175 1:30720048-30720070 CTCTTCCTCTCCAGGGGCCTGGG + Intronic
905374927 1:37514031-37514053 CTCTTCCTGCCCCCGCGTCTCGG - Intronic
906646667 1:47480077-47480099 CTCTTTCTCTCTCTCTGTCTCGG + Intergenic
907516488 1:54996505-54996527 CTCTTTCCCTCCCTGCCTCGGGG + Intergenic
908644789 1:66265721-66265743 CTCTTTTTCTCAGGGCTTCTTGG + Intronic
909540072 1:76781474-76781496 CTCTTTCTCTACCAGAGTATTGG + Intergenic
909594378 1:77389328-77389350 CACTTTCTTTCCTGGCGTTTGGG - Intronic
915972593 1:160365161-160365183 TTTTTTCTCTCCCTGAGTCTCGG + Intergenic
916598151 1:166266219-166266241 CTCATGCTCTCCCTGCCTCTTGG + Intergenic
920222160 1:204411851-204411873 CTGCGTCTCTTCCGGCGTCTAGG - Intergenic
920663649 1:207942340-207942362 CTCTTTCTCTCTCTGCTTCAGGG + Intergenic
1063874756 10:10462499-10462521 TTTTTTCTCTCCCTGCTTCTAGG + Intergenic
1065186633 10:23175011-23175033 CTTTTTCTGTCCCGGCAGCTAGG - Intergenic
1068705559 10:60071617-60071639 CTCTTTCCCTCCCTCTGTCTGGG + Exonic
1070651521 10:78240250-78240272 CTCTTTCTCTCCCTCCATCTCGG + Intergenic
1072016160 10:91348876-91348898 CTCTCTCTGTCTCGGAGTCTTGG - Intergenic
1073706211 10:105987277-105987299 CATTTTCTCTCCAGGCTTCTTGG - Intergenic
1074297821 10:112207331-112207353 CTCTTTATCTCCCTGGGTTTGGG - Intronic
1075640809 10:124063035-124063057 CTCTTTGCCTCCTGGTGTCTTGG - Intronic
1076815460 10:132912623-132912645 CTCTCTCTCTCTCGGCATCATGG + Intronic
1077867191 11:6232975-6232997 GTCTTTCTCTCCCTCCATCTTGG + Intronic
1081021710 11:37956578-37956600 CTCTTTCTCTCCAGTCATCAGGG - Intergenic
1083740527 11:64708631-64708653 CTCCTGCTCTCCCAGGGTCTGGG - Intronic
1085057222 11:73412255-73412277 CTCCTTCTCTCCTGGGCTCTAGG + Intronic
1089016517 11:115169626-115169648 CTCTTTCTCTCCCTCTCTCTAGG - Exonic
1089355702 11:117851287-117851309 CTCTCTCTCTCCCTCCCTCTCGG + Intronic
1090769897 11:129910648-129910670 CTCTTTCTCCCCAGGTATCTGGG - Exonic
1091276767 11:134358067-134358089 CTCTTTCCTTCCCCGCGTGTGGG + Intronic
1097167312 12:57092793-57092815 CTCTTTCTCGGCCAGCTTCTTGG + Intronic
1097167700 12:57094364-57094386 CTCTTTCTCTCCCGCCTCCTCGG - Intronic
1099738592 12:86601613-86601635 TTCTTTCGCTCCCGCAGTCTGGG - Intronic
1100851227 12:98713703-98713725 CTTTTTCTCACCAGGTGTCTGGG + Intronic
1103834037 12:123804819-123804841 ATCTTTCTCTCCAGGCGTGAAGG + Exonic
1119348398 14:73944633-73944655 CTCTTCCTCACCCTGCCTCTGGG + Exonic
1121349274 14:93160665-93160687 CTCTTGCACTCCTGCCGTCTTGG + Intergenic
1122081340 14:99269921-99269943 TTCTTTCTCTCGCGGTGCCTGGG - Intronic
1122297975 14:100716116-100716138 CTCTTTCTTTCTTGGAGTCTGGG + Intergenic
1122984406 14:105205594-105205616 CTCTTTCTCTTCTGGTGCCTTGG - Intergenic
1123129237 14:105972311-105972333 CTCATTCCCTCCCGGAGTCCAGG - Intergenic
1125754918 15:42057067-42057089 CCCTTTCTCGCCCGGTCTCTGGG - Intergenic
1126675301 15:51155527-51155549 CTCTTTCACTCCTTGCCTCTTGG - Intergenic
1130964664 15:88687984-88688006 CTCTCTCTCTCTCAGGGTCTAGG + Intergenic
1132140762 15:99392027-99392049 CTCTTTCTCTCCTCTCGTCTGGG - Intergenic
1133758976 16:8782823-8782845 CTCTTCATCTCCCGGTGCCTTGG + Exonic
1136002403 16:27304850-27304872 CTCTTGCTCTCCCCTCCTCTGGG + Intergenic
1136871053 16:33808557-33808579 CTTATTCTCTCCCGGAGTCCAGG + Intergenic
1137405965 16:48189719-48189741 CACTTTCCCACCCGGCCTCTGGG - Intronic
1137619085 16:49864618-49864640 CTCTTTCTCTCCCTCCTTCCTGG - Intergenic
1138930905 16:61654756-61654778 GTCTTTCTCACCCAGTGTCTTGG - Intronic
1139322372 16:66125879-66125901 CTCCCTCTCTCCGGGCTTCTTGG - Intergenic
1139963011 16:70728676-70728698 CTCCTTCTCGCCATGCGTCTTGG + Intronic
1140143679 16:72285029-72285051 CTCTCTCTCTCTCGGCAGCTTGG + Intergenic
1142267584 16:89071589-89071611 CTCTGTCTCTCGCGGAGGCTGGG - Intergenic
1203101119 16_KI270728v1_random:1307501-1307523 CTTATTCTCTCCCGGAGTCCAGG - Intergenic
1142785142 17:2215716-2215738 CTCTTTCTCTCTCTGCGTCTTGG - Intronic
1144574889 17:16423205-16423227 CTATTTCTTTCCCTGGGTCTGGG - Intronic
1147050289 17:37789433-37789455 CTCTTTCTGTACCAGCCTCTGGG + Intergenic
1150388416 17:64777520-64777542 CTCTTCCTCTCTCAGGGTCTCGG - Intergenic
1155249088 18:23938542-23938564 CTCTTTCTCTCCTGCTATCTTGG + Intronic
1160538624 18:79608657-79608679 CTCCGTCTCTCCCGGCTCCTCGG - Intergenic
1161172819 19:2821540-2821562 CTCTGTCTCTTCCAGCTTCTGGG + Intronic
1163002228 19:14375625-14375647 CTCTTAGTCTCCTGGGGTCTGGG - Intergenic
1163099049 19:15082464-15082486 TTCTCTCTCTCTCGGCCTCTAGG - Intergenic
1163827965 19:19534149-19534171 CTCTGTCTCTCCAGGCATTTTGG - Intronic
1166920269 19:46224419-46224441 CTCTTTCTCTCCTGCCATCATGG + Intergenic
1166943566 19:46383617-46383639 CCATTTCTCTCCTGGCCTCTTGG + Intronic
1168081925 19:54016372-54016394 CTCTTTCTTACCCGGGGTCAGGG + Intergenic
928222312 2:29414475-29414497 TTCTTTCTCTCCCTGCGAGTAGG + Intronic
928252048 2:29689610-29689632 GTTTTTCTCCCCCTGCGTCTGGG - Intronic
936956813 2:118030692-118030714 CTCTTTCTCTCCTGATTTCTTGG + Intergenic
937040345 2:118815916-118815938 CTCTTTGTCTCCTGGCTTCCAGG + Intergenic
937730121 2:125220516-125220538 CTCATTCTCTCCTGGCCTTTAGG + Intergenic
940293983 2:152103386-152103408 GTCTTCATCTCCCGGCTTCTTGG - Intergenic
940667381 2:156625450-156625472 CTCTTTTTCTCCCAGTGGCTGGG + Intergenic
944890885 2:204116141-204116163 CTCTCTCACTGCCTGCGTCTGGG - Intergenic
944987211 2:205191053-205191075 CTATTTCTTTCCTGGTGTCTGGG - Intronic
946413312 2:219526487-219526509 CTCTTTCTCTCCCATTGTCCTGG - Intronic
946932200 2:224681514-224681536 CTCTCTCTCTCTCGCTGTCTTGG - Intergenic
947906129 2:233764712-233764734 CTCTTTCTCTCCCTCTTTCTTGG - Intronic
1170529261 20:17273887-17273909 CTCTTTCTCTTCCAGTGTCCTGG - Intronic
1172313580 20:33936331-33936353 CTCATTCTGTGCCAGCGTCTGGG + Intergenic
1172732023 20:37096194-37096216 CTTTTTCTGTCCCGCCGGCTGGG - Intergenic
1173367358 20:42399034-42399056 CTCTTGCCCTCCCAGTGTCTGGG - Intronic
1173909005 20:46650337-46650359 CACTTTCTCTCCCCGAGCCTTGG + Intronic
1175736875 20:61393276-61393298 CTGTTTCTCTCCAGGTGTGTGGG - Intronic
1175761084 20:61562429-61562451 CTCTCTCTCTCCGGGAGTCCTGG - Intronic
1175928647 20:62482895-62482917 CTCTTTCTCTCCTGTCTTCCTGG + Intergenic
1178691417 21:34753449-34753471 CTCTCTCTCTCCTGGCACCTGGG + Intergenic
1179119281 21:38528051-38528073 CTCTCTCTCCCCCAGCTTCTGGG + Intronic
1182366866 22:29784855-29784877 CTCTCTCTCTCTCTGCTTCTGGG + Intergenic
1182717270 22:32367566-32367588 CTCGTTCTTTCCAGGTGTCTTGG + Intronic
1182816668 22:33170603-33170625 CTCTTTCTCTCCTGCCCCCTTGG + Intronic
1183785500 22:40026887-40026909 CTCTTGCTCTTGCTGCGTCTGGG + Intronic
949617256 3:5767689-5767711 CTCTTTCTCTCTCTGCCCCTGGG + Intergenic
951237312 3:20250895-20250917 TTCTTTCTTTCCAGGCCTCTGGG + Intergenic
951440163 3:22713456-22713478 GTCTTTCTCTCCCAGTTTCTAGG + Intergenic
951817915 3:26775599-26775621 CTTCTTCTCTCCAGGTGTCTTGG + Intergenic
954304304 3:49717401-49717423 CTCTTTCTGTCCTGGGGTGTGGG + Exonic
957843736 3:85703673-85703695 CTCTTTCTCTCCTCCTGTCTAGG - Intronic
959455485 3:106555078-106555100 CTCTCTCTCTCCCGTCCTCGTGG - Intergenic
960447178 3:117763047-117763069 CTCTCTCTCTCCCCGTCTCTGGG - Intergenic
960607964 3:119527811-119527833 CTCCTTCTCTCTCTGCATCTTGG + Exonic
963107653 3:141660368-141660390 CTCTCACTCTCCCTGCGTCCCGG - Intergenic
964471772 3:157064349-157064371 GTCTTTCTCTCCTGGCTTGTAGG + Intergenic
966193013 3:177288319-177288341 CTCTTTCTCTCATGGGTTCTTGG - Intergenic
969238280 4:5882860-5882882 CACTTTCTCTCCCTGGGCCTCGG - Intronic
970364256 4:15342192-15342214 GCCTTTCTCTCCCAGCCTCTCGG - Intronic
971658023 4:29374880-29374902 CTCTTTCTCTCTCTTCGTCATGG + Intergenic
974883656 4:67789392-67789414 CTCTTTGTCTCCTGTCGCCTTGG - Intergenic
981685974 4:147455439-147455461 CTCATACTCTCCTGGAGTCTGGG + Intergenic
983867429 4:172785570-172785592 CTCTTTCTCTGCTAGGGTCTAGG - Intronic
985277448 4:188251713-188251735 GGCTTTCTCTCCCGCCTTCTTGG + Intergenic
990139452 5:52686171-52686193 CTCTTACTCTGCTGGCGACTTGG - Intergenic
991517456 5:67453864-67453886 CTCTTTCTCAGCCTGGGTCTTGG + Intergenic
992705709 5:79389897-79389919 CTCTTTCTCTCCCTGTTTTTTGG - Intronic
998526658 5:142848866-142848888 CTCTTTCTTTCCCGCCTACTTGG + Intronic
999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG + Intronic
999963190 5:156779162-156779184 CTCTTTCTCTCCCTTCTTGTTGG - Intergenic
1001475699 5:172049095-172049117 CTGTTTCCCTCCCTGCTTCTTGG + Intronic
1002205799 5:177561825-177561847 CTCTCTCTCTCCCCCCGCCTTGG + Intergenic
1002877592 6:1225415-1225437 CTCTTTCTCCCCCGAGTTCTAGG - Intergenic
1005196995 6:23298702-23298724 CTCTATGTCTCCCCGCGTTTCGG + Intergenic
1007135459 6:39517043-39517065 CTCCTGCTCTCCAGGCCTCTAGG + Intronic
1007829890 6:44630081-44630103 CTCTTTCTCTCCCCTCTTCCAGG + Intergenic
1013546251 6:111160781-111160803 CTCTCTCTCTCTCTGTGTCTGGG + Intronic
1015641055 6:135332619-135332641 CTCTTTCTCTCCCAATTTCTTGG - Intronic
1015898045 6:138035774-138035796 CTCTTTCTCTCCATGCTTGTAGG - Intergenic
1024047175 7:45592741-45592763 CTCCTTCTCTCCCTGCAGCTCGG + Exonic
1027265977 7:76495484-76495506 CTCCTCCTCTCCAGGCTTCTGGG + Intronic
1027317351 7:76993601-76993623 CTCCTCCTCTCCAGGCTTCTGGG + Intergenic
1028063404 7:86350009-86350031 CCCTTTCTCTCCAGGCCTCTTGG - Intergenic
1032800030 7:135310427-135310449 CTCTTTCTCTCCAGGGGTGTGGG - Intergenic
1033572583 7:142646752-142646774 CTCTTTTTCTCCAGGCCTCGTGG + Intergenic
1033598288 7:142871593-142871615 CTCTTTCTCCCCTGGGGCCTGGG + Exonic
1035353144 7:158260811-158260833 AGCTTTCTCTCCTGGCTTCTGGG - Intronic
1036181724 8:6591502-6591524 ATCTTTCTCTCCTGTCCTCTAGG + Intronic
1037826757 8:22164697-22164719 CTCTGTCTCTCTCGCTGTCTTGG - Intergenic
1038035403 8:23682608-23682630 CTCGGTCTCTGCCAGCGTCTCGG + Exonic
1038263642 8:26019701-26019723 CTCTTTCTCTCCTGGTCTCTGGG + Intronic
1039058458 8:33554943-33554965 CACTTCCTCTCCCTGCTTCTCGG - Intronic
1044634032 8:94304571-94304593 CTCTCTCTCACCCGTTGTCTGGG - Intergenic
1044880759 8:96719727-96719749 CTCTATCTCTCCTGGAGACTGGG + Intronic
1048178209 8:132171658-132171680 CTCTTTCTCTCTTGGCTTATGGG + Intronic
1048207652 8:132428098-132428120 CTCTGTCTCTCTCGACTTCTCGG + Intronic
1050085954 9:1965858-1965880 CTTTTTTTCTCCCTCCGTCTTGG - Intergenic
1050379221 9:5008921-5008943 CTCTTTCTCTTTCTGAGTCTAGG + Intronic
1050472466 9:6007755-6007777 CTCCATCGCTCCCGGCGTCCCGG + Exonic
1054933792 9:70665148-70665170 CTCTTCCTCTTCCCGGGTCTAGG + Intronic
1056432420 9:86540802-86540824 ATGTTTCTCTCCTGGCTTCTGGG - Intergenic
1058005742 9:99911937-99911959 CTCTTTCTCGCCAGGCGTCGTGG + Intronic
1059428022 9:114233227-114233249 CTCTTTCTCTCCCTGGGTCTTGG - Intronic
1060106147 9:120874749-120874771 TTCTTTCTCTCCCAGTGTCAGGG - Exonic
1060489238 9:124070029-124070051 GCCTTTCTCTCCCCGCCTCTTGG + Intergenic
1193308386 X:79976040-79976062 CTCTGTCTCTGCTGGAGTCTGGG + Intergenic
1199120140 X:144042166-144042188 CTCTCTCTCTCTCGGCCTCTAGG - Intergenic