ID: 901361361

View in Genome Browser
Species Human (GRCh38)
Location 1:8703407-8703429
Sequence GCTCTTTCTCTCCCGGCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361361_901361363 -7 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361361_901361364 -4 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361361_901361370 13 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361370 1:8703443-8703465 CGGCGGCGGCCGGCAAAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 62
901361361_901361371 14 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361371 1:8703444-8703466 GGCGGCGGCCGGCAAAACCCGGG 0: 1
1: 0
2: 1
3: 5
4: 87
901361361_901361366 3 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361361_901361372 18 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361361_901361365 -1 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361361 Original CRISPR GCTCTTTCTCTCCCGGCGTC TGG (reversed) Intronic
900866246 1:5270580-5270602 GCTCTTTCTCCTCCTGCATCAGG - Intergenic
901060333 1:6468894-6468916 GCTCTGTCTCCCCCAGAGTCCGG - Intronic
901361361 1:8703407-8703429 GCTCTTTCTCTCCCGGCGTCTGG - Intronic
901428264 1:9197349-9197371 GCTCCCTCTCTTCCGGAGTCTGG + Intergenic
901831203 1:11893732-11893754 GCTCTGTCTCTCTGGGCCTCAGG - Intergenic
906509223 1:46401266-46401288 GCTCTGTCTCTCCCCACATCTGG + Intronic
907516487 1:54996504-54996526 GCTCTTTCCCTCCCTGCCTCGGG + Intergenic
911101850 1:94101657-94101679 TCTCGTTCTCTCCTGGAGTCTGG + Intronic
914239728 1:145845661-145845683 GCTGCTCCTGTCCCGGCGTCCGG + Exonic
916179742 1:162072947-162072969 GCTCTTTCTCTCCCAAGGGCTGG + Intronic
920319220 1:205104995-205105017 GCTATTTCTCTCCTGGGGTGGGG - Intronic
920663648 1:207942339-207942361 TCTCTTTCTCTCTCTGCTTCAGG + Intergenic
1076597963 10:131637619-131637641 GCCCTTCCTATCCCGGCCTCTGG - Intergenic
1078599280 11:12716118-12716140 GCTCTTTGTCTGTCGGCTTCCGG + Intronic
1079193435 11:18302163-18302185 TCTCTTTCTCTCCAGTCCTCTGG + Intronic
1080421967 11:32118354-32118376 GCACTTTCTCTCCTGACCTCAGG - Intergenic
1081021711 11:37956579-37956601 TCTCTTTCTCTCCAGTCATCAGG - Intergenic
1084499123 11:69524588-69524610 GCCCTCTCCCTCCCGGCGGCTGG + Intergenic
1085334160 11:75678477-75678499 GCTCTTTCAGTCCCGCCATCTGG + Intergenic
1085435234 11:76493823-76493845 GCTCTTTCAGTCCCGGCATTTGG - Intronic
1088840565 11:113624216-113624238 GCTCTTTCTTTCACGGCATGAGG - Intergenic
1090238362 11:125165402-125165424 GTTCTCTTTCTCCCGGCTTCGGG + Intronic
1091276766 11:134358066-134358088 GCTCTTTCCTTCCCCGCGTGTGG + Intronic
1092956037 12:13551120-13551142 GTTCTCTCTCTCCCAGGGTCAGG - Exonic
1100799153 12:98213124-98213146 AATCTTTCTCTCCCAGCGCCAGG - Intergenic
1101592965 12:106139404-106139426 GCTCTTTCTTCCCCGGCCCCGGG - Exonic
1104250745 12:127091088-127091110 TCTCCTTCTCTCCAGGCCTCTGG - Intergenic
1104898706 12:132176468-132176490 GCTCCTGCTTTCCCAGCGTCCGG + Intergenic
1110713660 13:78677314-78677336 GCTCCTTCTCTCCCAGAGGCAGG - Intergenic
1112405412 13:99115515-99115537 GCTCTTTCTCTCCATGAGTGGGG + Intergenic
1122081341 14:99269922-99269944 GTTCTTTCTCTCGCGGTGCCTGG - Intronic
1123030785 14:105450137-105450159 GCTGTTCCTCTCCCGGCAGCTGG + Exonic
1123151437 14:106185471-106185493 GCTCTTTCTCATCCTGGGTCAGG - Intergenic
1125754920 15:42057068-42057090 GCCCTTTCTCGCCCGGTCTCTGG - Intergenic
1126675718 15:51157967-51157989 GCCCTTTCTCTGCTGGCTTCTGG - Intergenic
1129461371 15:75701632-75701654 TCCTTTTCTCTCCCGGCCTCAGG + Intronic
1129723463 15:77890175-77890197 TCCTTTTCTCTCCCGGCCTCAGG - Intergenic
1132140763 15:99392028-99392050 CCTCTTTCTCTCCTCTCGTCTGG - Intergenic
1133388715 16:5391639-5391661 GCTCTTTCTCTTCCAACTTCAGG + Intergenic
1133739238 16:8639386-8639408 GCTCTTTCTCTCCCGGACACTGG + Intronic
1134418922 16:14068893-14068915 TCTCTTTCTCTTCCGGAGCCAGG + Intergenic
1135574937 16:23578308-23578330 GCTGTTTCACTGCAGGCGTCTGG + Intergenic
1136073425 16:27802588-27802610 GCTCTTTCCCCACCGGCCTCTGG + Intronic
1137427757 16:48394133-48394155 GCTGATTCTCTCCGGGCCTCAGG - Intronic
1139705574 16:68738197-68738219 CCTCCCTCGCTCCCGGCGTCGGG - Intronic
1144831779 17:18135925-18135947 GCTCTCTCTGTCCCTGGGTCAGG + Intronic
1146558688 17:33849524-33849546 GCTATTTCCCTCCCAGAGTCAGG + Intronic
1147050288 17:37789432-37789454 GCTCTTTCTGTACCAGCCTCTGG + Intergenic
1147989519 17:44324446-44324468 GCTCTTTCTCTCCGGGCCCCGGG - Intronic
1148833779 17:50454455-50454477 GCTCCTGCTGTCCAGGCGTCAGG + Intronic
1150240003 17:63623093-63623115 GCTCTTGCTCCCCCGCCCTCGGG - Intronic
1150914015 17:69417782-69417804 CCTCTTTCTCTCCCTCCCTCCGG - Intronic
1153814650 18:8782105-8782127 GCTCGTTCTCTGCCGCAGTCTGG - Intronic
1157362725 18:47034250-47034272 GCTCTTTCTCCTCGGGCGACAGG + Exonic
1159088609 18:63821792-63821814 CCTCTTTCTCTACCTGCATCTGG - Intergenic
1160534179 18:79583573-79583595 GCTCTTTCTCTCCCAACTCCAGG - Intergenic
1161018775 19:1997734-1997756 TCTCTTTCCTTCCAGGCGTCAGG + Intronic
1161701690 19:5799408-5799430 GCTCCTTATCTCCTGGCTTCAGG + Intergenic
1164375507 19:27680232-27680254 GCTCTTGATCTCCTGACGTCAGG - Intergenic
1168081924 19:54016371-54016393 ACTCTTTCTTACCCGGGGTCAGG + Intergenic
926347640 2:11962949-11962971 ACTCTTTCTCTTTCGGCCTCTGG + Intergenic
928252049 2:29689611-29689633 GGTTTTTCTCCCCCTGCGTCTGG - Intronic
928392578 2:30920797-30920819 GCTCTGTCTCACCCAGCATCAGG + Intronic
932231365 2:70086932-70086954 GCCCTTTCGTCCCCGGCGTCCGG - Intergenic
933232643 2:79826882-79826904 TCTCTTTCTCTTCCTGAGTCCGG - Intronic
933810283 2:86028789-86028811 GCTCTCTCTCTCCTTGTGTCTGG + Intronic
933851680 2:86372494-86372516 GCTCTTTCTCTCCAGAACTCTGG + Intergenic
934486905 2:94724579-94724601 GCTCTATCTCCCCCGGCCCCAGG - Intergenic
934488537 2:94739327-94739349 GCTCTATCTCCCCCGGCCCCAGG + Intergenic
937136700 2:119559673-119559695 TCTTTTTCTCTCCCAGCATCTGG + Exonic
937332257 2:121038875-121038897 GCTGTTTCTCTGCTGTCGTCAGG - Intergenic
938754319 2:134365671-134365693 TCTCTTTCTCTCCAGGCTGCAGG - Intronic
939321193 2:140624988-140625010 GCTCTCTCTTTCCCGGCTCCTGG - Intronic
939542040 2:143505845-143505867 GCACTTTCTCTCTCAGCCTCAGG - Intronic
946690187 2:222303644-222303666 GCTCTTTATGTACCGGCGCCCGG - Intronic
948088569 2:235271099-235271121 GCTCTTTCTCTTTCTGCGGCTGG - Intergenic
948428252 2:237902112-237902134 GCTCCTTCTCTCTCGGCCTTGGG - Intronic
1169068935 20:2709865-2709887 GCTCCTTCTCTCAGGGAGTCGGG - Intronic
1169694793 20:8375213-8375235 GCTCTCTCTCTCCCTCCTTCCGG + Intronic
1170338988 20:15302092-15302114 GCTCTTTGGCTCCCAGCATCTGG + Intronic
1171195635 20:23196430-23196452 GCTCTTTAACTCCTGGCCTCAGG - Intergenic
1173165062 20:40682403-40682425 GCTCTTCCTGTCCTGGCTTCTGG - Intergenic
1173367359 20:42399035-42399057 GCTCTTGCCCTCCCAGTGTCTGG - Intronic
1177418449 21:20825086-20825108 CCTCTCTCTCTCCTGGCATCTGG - Intergenic
1178580183 21:33831681-33831703 GCTCTTCCTGTCCTGGCCTCAGG - Intronic
1179119280 21:38528050-38528072 GCTCTCTCTCCCCCAGCTTCTGG + Intronic
1181805806 22:25373828-25373850 GATCTTTCTTTCCAGGTGTCAGG - Intronic
1184099842 22:42336304-42336326 CCTCTCTCTCTCCAGGCCTCAGG + Intronic
1185037324 22:48486324-48486346 GGTCTCTCTCTCCAGGCCTCTGG + Intergenic
957185712 3:76938751-76938773 GATCTTTATCTCCCGACCTCAGG - Intronic
958516624 3:95124928-95124950 GCTTTTTCACTCCCGTCGTTCGG + Intergenic
959117493 3:102195350-102195372 GCTCTTGCTCTTCCTGCTTCAGG + Intronic
959354904 3:105313508-105313530 CCTCTGTCTCTCCCTGCCTCTGG - Intergenic
961058463 3:123808602-123808624 GCTCTTTCTCTACTGTCCTCAGG + Intronic
964862204 3:161215345-161215367 GCTCTCTCTCTCCCGCTGTGTGG + Intronic
968353641 3:198081849-198081871 GCTCTTCCTCTGCCGGAGCCTGG + Intergenic
980174938 4:129333241-129333263 GCTCATTCTCACCCGGGGTTGGG + Intergenic
981846081 4:149171389-149171411 GCTCTTTGTCTCCCAGCATCAGG + Intergenic
982123060 4:152160694-152160716 GCTCTTTCCATCCCTGCATCAGG + Intergenic
984455468 4:179961362-179961384 CCTCTTTGTCTCCCACCGTCTGG - Intergenic
985123700 4:186669259-186669281 GCTCTGTTGCTCCCGGCATCTGG - Intronic
985930831 5:3056476-3056498 GCTCCCTCTCCCCCGGCGGCGGG + Intergenic
992119433 5:73575935-73575957 GCTCTTTAACTCCCGACCTCAGG + Intronic
997956825 5:138285369-138285391 ACTCTTTCTCTCTGGGCTTCGGG - Exonic
998292269 5:140926808-140926830 GCTCGTGCTCTCCAGGAGTCCGG + Intronic
1000193842 5:158939012-158939034 GCTCTTGCTCTCCTGGAGACTGG - Intronic
1004582262 6:16965623-16965645 GCTCTTTCTGCCCCAGCGTTTGG + Intergenic
1005427300 6:25716207-25716229 GCTCTTTCCCTGCGGGCGTGGGG + Intergenic
1008542604 6:52558251-52558273 GCTCCTTCTCTTCTGGCATCCGG - Intronic
1015800603 6:137058370-137058392 TCTCTCTCTCTCCTGGCTTCTGG - Intergenic
1021392302 7:20107878-20107900 TCTCTTTCTCTCTCAGCTTCAGG - Intergenic
1022089473 7:27098097-27098119 GCTCCTTCTCTCCCCGCCGCTGG - Intergenic
1024533712 7:50412995-50413017 ACCCCTTCTCTCCAGGCGTCTGG - Intergenic
1032800031 7:135310428-135310450 TCTCTTTCTCTCCAGGGGTGTGG - Intergenic
1036569306 8:9965862-9965884 GCTCTTTCTCTGCCTGTGTGCGG - Intergenic
1038263641 8:26019700-26019722 GCTCTTTCTCTCCTGGTCTCTGG + Intronic
1041108948 8:54467472-54467494 GCTCCGCCTCCCCCGGCGTCGGG - Intergenic
1042945877 8:74154036-74154058 CCTCTCTCTCTCCCAGCTTCTGG + Intergenic
1049095912 8:140547961-140547983 GCTCTTTCTCTCCTGCCCTGGGG - Intronic
1049238252 8:141523563-141523585 GCGCTTTCTCTGCTGGCCTCTGG + Intergenic
1049310222 8:141930241-141930263 GGTCTTTGTCTCCCGGCACCAGG - Intergenic
1049356412 8:142191152-142191174 GCTCTGTCTCTCCCTGTCTCTGG + Intergenic
1052885031 9:33638064-33638086 GCTCTTTGTCTCCTGGCAGCAGG + Intergenic
1053669251 9:40345037-40345059 GCTCTATCTCTCCCGGCCCCAGG - Intergenic
1053670889 9:40359750-40359772 GCTCTATCTCTCCCGGCCCCAGG + Intergenic
1053919053 9:42971277-42971299 GCTCTATCTCCCCCGGCCCCAGG - Intergenic
1053920691 9:42986123-42986145 GCTCTATCTCCCCCGGCCCCAGG + Intergenic
1054380384 9:64485059-64485081 GCTCTATCTCTCCTGGCTCCAGG - Intergenic
1054382009 9:64499812-64499834 GCTCTATCTCTCCCGGCTCCAGG + Intergenic
1054513724 9:66016551-66016573 GCTCTATCTCTCCCGGCCCCAGG - Intergenic
1054515365 9:66031253-66031275 GCTCTATCTCTCCCGGCTCCAGG + Intergenic
1057979620 9:99647539-99647561 GGTCTTTCACTCCTGGCCTCAGG - Intergenic
1060106148 9:120874750-120874772 GTTCTTTCTCTCCCAGTGTCAGG - Exonic
1061601823 9:131675301-131675323 GCTCTTGCCCTCCCTGAGTCAGG - Intronic
1186261620 X:7786122-7786144 GCTCTCTTTCTCCTGTCGTCTGG + Intergenic
1190804376 X:53820930-53820952 GCTCTTTCTCTGCAGGAGCCTGG + Intergenic
1199076337 X:143530548-143530570 GCTCTTGCTCTTCCAGCTTCCGG + Intergenic
1200229199 X:154435737-154435759 GCTTCTTCTCCCCCGGCATCTGG + Exonic
1201851720 Y:18490297-18490319 GCTCTTTCTCTCCACACGTTGGG - Intergenic
1201881600 Y:18830083-18830105 GCTCTTTCTCTCCACACGTTGGG + Intergenic