ID: 901361363

View in Genome Browser
Species Human (GRCh38)
Location 1:8703423-8703445
Sequence AAAGAGCAGACTCCCCGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361356_901361363 8 Left 901361356 1:8703392-8703414 CCACATGCCGGTGACCCAGACGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361360_901361363 -6 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361352_901361363 30 Left 901361352 1:8703370-8703392 CCGGGAGGCCGGGCCAGCACTGC 0: 1
1: 1
2: 4
3: 25
4: 366
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361359_901361363 1 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361353_901361363 22 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361355_901361363 17 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50
901361361_901361363 -7 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361363 1:8703423-8703445 AAAGAGCAGACTCCCCGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361363 Original CRISPR AAAGAGCAGACTCCCCGCGA CGG Intronic