ID: 901361364

View in Genome Browser
Species Human (GRCh38)
Location 1:8703426-8703448
Sequence GAGCAGACTCCCCGCGACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361355_901361364 20 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361360_901361364 -3 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361353_901361364 25 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361359_901361364 4 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361361_901361364 -4 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47
901361356_901361364 11 Left 901361356 1:8703392-8703414 CCACATGCCGGTGACCCAGACGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 901361364 1:8703426-8703448 GAGCAGACTCCCCGCGACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361364 Original CRISPR GAGCAGACTCCCCGCGACGG CGG Intronic