ID: 901361365

View in Genome Browser
Species Human (GRCh38)
Location 1:8703429-8703451
Sequence CAGACTCCCCGCGACGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361361_901361365 -1 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361362_901361365 -8 Left 901361362 1:8703414-8703436 CCGGGAGAGAAAGAGCAGACTCC 0: 1
1: 1
2: 2
3: 23
4: 250
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361359_901361365 7 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361353_901361365 28 Left 901361353 1:8703378-8703400 CCGGGCCAGCACTGCCACATGCC 0: 1
1: 0
2: 3
3: 26
4: 342
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361355_901361365 23 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361356_901361365 14 Left 901361356 1:8703392-8703414 CCACATGCCGGTGACCCAGACGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
901361360_901361365 0 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361365 Original CRISPR CAGACTCCCCGCGACGGCGG CGG Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901934526 1:12618384-12618406 CGCGCTCCCCGCGACGGCGCAGG - Intergenic
905399695 1:37692346-37692368 AGGAGTACCCGCGACGGCGGCGG + Intergenic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG + Intergenic
1071618128 10:87094822-87094844 CAGACTCCCCGCGACTAGGGAGG + Exonic
1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG + Intronic
1080503669 11:32892854-32892876 GGGACTCGCGGCGACGGCGGCGG - Intergenic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1084746140 11:71171226-71171248 CAGAGTCCCCGCGATGACAGAGG + Intronic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1107544868 13:41426151-41426173 ATGACTCCCCGCAACGCCGGTGG + Intergenic
1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG + Intronic
1114523401 14:23352579-23352601 CAGACGCTCCGCGGGGGCGGGGG + Intronic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1123062626 14:105601148-105601170 CAGTCGTCCTGCGACGGCGGCGG - Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1133117913 16:3588840-3588862 CAGACTCCCCTCCACAGTGGAGG - Intronic
1137261057 16:46830762-46830784 CAGACTCTCCTCGCCGGCGGCGG - Intronic
1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG + Intergenic
1142354327 16:89595170-89595192 CAGAGTGCCCGCCACGGAGGGGG + Intronic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG + Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG + Intronic
1162410687 19:10503266-10503288 CCGAGGCCCCCCGACGGCGGAGG - Exonic
1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG + Intergenic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
1172583169 20:36064532-36064554 CAGAGTCCCCGCTACGGGGTCGG - Intergenic
1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG + Intergenic
1185129863 22:49032810-49032832 CAGACACCCCGGGCCGGCAGAGG + Intergenic
1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG + Intronic
1185413588 22:50698090-50698112 CAGACACCCCACGACGGCAAGGG - Intergenic
949877130 3:8633776-8633798 CAGAGTCCCTGCGATGACGGAGG - Exonic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
953598349 3:44338533-44338555 CACCCTCCCCGCTCCGGCGGCGG - Exonic
955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG + Exonic
960602126 3:119468982-119469004 CAGATTCCCCGCTGCGGCGCTGG - Exonic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968756413 4:2418428-2418450 CAGCCTCCCTGCGACAGCGCGGG - Exonic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
978617927 4:110614361-110614383 GGGAGTCCCGGCGACGGCGGCGG + Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
1005529636 6:26689831-26689853 CGGACGCCTCGCGACGGCCGCGG + Intergenic
1005541160 6:26811816-26811838 CGGACGCCTCGCGACGGCCGCGG - Intergenic
1007752021 6:44076597-44076619 CAGAGTCCCCGCCACGCCGCCGG - Intergenic
1009011969 6:57853888-57853910 CGGACGCCTCGCGACGGCCGCGG - Intergenic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1035569351 8:661926-661948 CAGAATCCCTGCCACTGCGGGGG - Intronic
1036562095 8:9906405-9906427 CAGAGTCCCCTCGGCGGCCGCGG + Intergenic
1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG + Intergenic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1045188211 8:99858915-99858937 AAGCCTCCCCGGGACAGCGGAGG - Intronic
1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG + Intergenic
1196740180 X:119017725-119017747 AAGACTCCCCCCGACGGCAGTGG - Exonic
1196965176 X:121047610-121047632 CAGACTCCCCGCGACTAGGAAGG - Exonic
1199746657 X:150776039-150776061 CAGACTTCCTGGGACGGGGGTGG - Intronic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic