ID: 901361366

View in Genome Browser
Species Human (GRCh38)
Location 1:8703433-8703455
Sequence CTCCCCGCGACGGCGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361359_901361366 11 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361362_901361366 -4 Left 901361362 1:8703414-8703436 CCGGGAGAGAAAGAGCAGACTCC 0: 1
1: 1
2: 2
3: 23
4: 250
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361355_901361366 27 Left 901361355 1:8703383-8703405 CCAGCACTGCCACATGCCGGTGA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361361_901361366 3 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361356_901361366 18 Left 901361356 1:8703392-8703414 CCACATGCCGGTGACCCAGACGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165
901361360_901361366 4 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361366 1:8703433-8703455 CTCCCCGCGACGGCGGCGGCCGG 0: 1
1: 0
2: 4
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361366 Original CRISPR CTCCCCGCGACGGCGGCGGC CGG Intronic