ID: 901361372

View in Genome Browser
Species Human (GRCh38)
Location 1:8703448-8703470
Sequence GCGGCCGGCAAAACCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361361_901361372 18 Left 901361361 1:8703407-8703429 CCAGACGCCGGGAGAGAAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361367_901361372 -10 Left 901361367 1:8703435-8703457 CCCCGCGACGGCGGCGGCCGGCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361359_901361372 26 Left 901361359 1:8703399-8703421 CCGGTGACCCAGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361360_901361372 19 Left 901361360 1:8703406-8703428 CCCAGACGCCGGGAGAGAAAGAG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57
901361362_901361372 11 Left 901361362 1:8703414-8703436 CCGGGAGAGAAAGAGCAGACTCC 0: 1
1: 1
2: 2
3: 23
4: 250
Right 901361372 1:8703448-8703470 GCGGCCGGCAAAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361372 Original CRISPR GCGGCCGGCAAAACCCGGGC TGG Intronic