ID: 901361563

View in Genome Browser
Species Human (GRCh38)
Location 1:8705382-8705404
Sequence AGGCTTCTTCCCACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901361554_901361563 17 Left 901361554 1:8705342-8705364 CCACTTCCCCCAGGTATAGGGAT 0: 1
1: 0
2: 2
3: 32
4: 274
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225
901361556_901361563 10 Left 901361556 1:8705349-8705371 CCCCAGGTATAGGGATTTCTACC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225
901361555_901361563 11 Left 901361555 1:8705348-8705370 CCCCCAGGTATAGGGATTTCTAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225
901361550_901361563 26 Left 901361550 1:8705333-8705355 CCAGTTTTTCCACTTCCCCCAGG 0: 1
1: 0
2: 4
3: 34
4: 340
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225
901361558_901361563 8 Left 901361558 1:8705351-8705373 CCAGGTATAGGGATTTCTACCAC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225
901361557_901361563 9 Left 901361557 1:8705350-8705372 CCCAGGTATAGGGATTTCTACCA 0: 1
1: 0
2: 2
3: 1
4: 108
Right 901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG 0: 1
1: 1
2: 1
3: 28
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901361563 Original CRISPR AGGCTTCTTCCCACCAGAGC AGG Intronic
900466070 1:2826077-2826099 CGGCTTCTGCCCACCAGTGGGGG - Intergenic
900533646 1:3166730-3166752 TGGCTTCTCCCCACCTGGGCCGG - Intronic
900745666 1:4359174-4359196 AGGCTTCCTACCTCCAGAACTGG + Intergenic
900821938 1:4896512-4896534 AGACTTCCACCCTCCAGAGCTGG + Intergenic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
902231387 1:15029864-15029886 CAGCTTCTTTCCACCGGAGCAGG + Intronic
902921943 1:19671529-19671551 CTCTTTCTTCCCACCAGAGCTGG + Intronic
903350328 1:22712921-22712943 AGGCCTCTTCCAACGAGAGAGGG - Intronic
905445542 1:38026426-38026448 AGGGCCCTTCCCACCAAAGCAGG + Intergenic
905941799 1:41868999-41869021 AGGCTTGTTCCCAGCAAAGGTGG + Intronic
910433019 1:87177434-87177456 AGACATCTTGCCACCTGAGCAGG + Intergenic
911176097 1:94820161-94820183 CCTCTTCCTCCCACCAGAGCAGG + Intergenic
913564353 1:120057396-120057418 AACCTTCTCCCCACCAAAGCTGG + Intronic
913633775 1:120736168-120736190 AACCTTCTCCCCACCAAAGCTGG - Intergenic
914284940 1:146216745-146216767 AACCTTCTCCCCACCAAAGCTGG + Intronic
914545971 1:148667484-148667506 AACCTTCTCCCCACCAAAGCTGG + Intronic
914620593 1:149403182-149403204 AACCTTCTCCCCACCAAAGCTGG - Intergenic
915474362 1:156144497-156144519 AGGCCTCGTGCCACCACAGCTGG - Intergenic
915632982 1:157166340-157166362 GGGCTTTTTCCCACCAGAAATGG + Intergenic
916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG + Intronic
916949942 1:169769551-169769573 AAGCTGCTTCCCATCAGATCAGG - Intronic
917925496 1:179786242-179786264 ATGCTCCTTCCCACCAGCCCTGG + Intronic
918218059 1:182410308-182410330 ACTCCTCTTCCCACCAGAGAGGG + Intergenic
918338503 1:183546289-183546311 AGGAGTCTTCCGTCCAGAGCAGG + Exonic
924275028 1:242377210-242377232 ATGGTTCTTCCTACCAGTGCCGG - Intronic
1066503185 10:36014717-36014739 TGCCTCCTTCCCACCTGAGCTGG - Intergenic
1067523845 10:47026832-47026854 AAGCTTCACCCCACCAGAGGAGG + Intergenic
1067738834 10:48880091-48880113 AGGCTGCTGCCCCCCAGGGCAGG + Intronic
1068739004 10:60447762-60447784 AGGCTTCTTTCCACCATATTAGG - Intronic
1075569615 10:123530372-123530394 GAGCTTCTTCCAGCCAGAGCTGG + Intergenic
1075777663 10:124998774-124998796 TGAGTTCTTCCCAGCAGAGCAGG - Intronic
1076384657 10:130047583-130047605 AGGCTTCCTGCGTCCAGAGCTGG + Intergenic
1076732789 10:132446786-132446808 AGGCTCCTTCCCAGCAGGGTGGG - Intronic
1076746313 10:132516413-132516435 AGGCACCTTCCCACCACAGCCGG - Intergenic
1077179764 11:1207104-1207126 AGGCTCATTCCCACCCGGGCAGG + Intergenic
1078094587 11:8288998-8289020 AGGCTTCCTTCCCCCAGAGCCGG - Intergenic
1078391471 11:10938820-10938842 AGGCTGATTCACACCAGAGCAGG - Intergenic
1083558063 11:63648270-63648292 AAGCTTCTACCCACCAAGGCAGG + Intronic
1084161478 11:67352802-67352824 AGTCTTCTTCCCACCCTGGCAGG - Exonic
1084517371 11:69644129-69644151 GGGCCTCTGCTCACCAGAGCTGG - Intronic
1084805176 11:71573759-71573781 ACGTTTCTGCCCACCAGACCTGG - Intergenic
1085325360 11:75602270-75602292 AGGCTTCTTCCAACTAGGGCTGG - Intronic
1089498873 11:118921585-118921607 AGGCCCCCTTCCACCAGAGCTGG - Intronic
1090965093 11:131591352-131591374 AGGCTTCGTCCCTCCCCAGCAGG - Intronic
1091151987 11:133337560-133337582 AGGCTTCTTCCCACAGCAGCAGG - Intronic
1092084188 12:5742188-5742210 AGCCTTATTCCCAGCAGACCTGG + Intronic
1092383715 12:8019192-8019214 AGCCTTCTTCCCAGCCCAGCCGG - Intergenic
1093093428 12:14946177-14946199 AGGCTTCTTCCCCCTGGAGTGGG - Intronic
1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG + Intronic
1094679781 12:32657939-32657961 ACTGTTCTTCCCAGCAGAGCAGG - Intergenic
1095954090 12:47796727-47796749 TGCTTTCTTCCCATCAGAGCAGG + Intronic
1096588503 12:52641901-52641923 AGGGTTCTTTTCATCAGAGCTGG + Intergenic
1100386436 12:94108829-94108851 AGTCTTCATCACACCAGACCTGG + Intergenic
1100519548 12:95360400-95360422 AGGCCTCTTCTCAACACAGCAGG + Intergenic
1101837196 12:108303903-108303925 AGCCTTCTGCGCCCCAGAGCTGG + Intronic
1102597206 12:114001945-114001967 AGGCTTCTATCCACCAATGCAGG - Intergenic
1103578065 12:121893515-121893537 AGACTTCTGGCCTCCAGAGCTGG - Intronic
1104447273 12:128844643-128844665 AGACTTCTGTCCTCCAGAGCCGG + Intergenic
1104447284 12:128844697-128844719 AGACTTCTGTCCTCCAGAGCTGG + Intergenic
1104478004 12:129085803-129085825 TTGCTTCTTCCCATCAGCGCTGG - Intronic
1104635876 12:130437607-130437629 AGGTTTATTACCACCACAGCTGG + Intronic
1108972358 13:56393013-56393035 GGGCTTGTTCCCAACAGAGTGGG + Intergenic
1111574033 13:90127051-90127073 AGGCTTCTTCCCTCCATAGTGGG - Intergenic
1111589294 13:90322991-90323013 AGACTTCTCCAAACCAGAGCAGG - Intergenic
1112912747 13:104508827-104508849 AGGCTTTTCTCCACCAGAGTCGG - Intergenic
1115303823 14:31914016-31914038 TGGCTGCTTGCCTCCAGAGCAGG + Intergenic
1116871269 14:50071004-50071026 AGACTTCTGTCCTCCAGAGCAGG - Intergenic
1118046056 14:61972751-61972773 GGGCTTCTTCCCACCACACTAGG - Intergenic
1121358607 14:93234975-93234997 CGCCATCTTCCCCCCAGAGCTGG + Intergenic
1122331925 14:100924658-100924680 AGGCTTGTTTCCCACAGAGCTGG - Intergenic
1123834025 15:24169653-24169675 AGGCTGTTTCCCTCCAGGGCCGG + Intergenic
1123840754 15:24244693-24244715 AGGCTGTTTCCCTCCAGGGCTGG + Intergenic
1123849815 15:24343218-24343240 AGGCTATTTCCCTCCAGGGCTGG + Intergenic
1123853709 15:24385196-24385218 AGGCTGTTTCCCTCCAGGGCTGG + Intergenic
1123869676 15:24557813-24557835 AGGCTGTTTCCCTCCAGGGCTGG + Intergenic
1124127805 15:26953466-26953488 AGCCTTGTTGCCACCAGAGGGGG + Intergenic
1128159290 15:65412792-65412814 AGGGATCCTCCCACCACAGCTGG - Intronic
1128221958 15:65975566-65975588 AGTGCTCTTCCCACCAGACCAGG - Intronic
1128347706 15:66864970-66864992 ATGGTTCCACCCACCAGAGCTGG - Intergenic
1128453124 15:67818619-67818641 AGGCTTCCACCCCACAGAGCAGG - Intergenic
1130168702 15:81488876-81488898 AGGCTCTTTCCTTCCAGAGCTGG + Intergenic
1130650769 15:85760891-85760913 AGGCTGCTGCTCCCCAGAGCTGG + Exonic
1131339046 15:91579135-91579157 ATGCTTCTTCCCAGCACAACTGG + Intergenic
1132091951 15:98954262-98954284 AAGCTGCTTCCCAGCAGGGCAGG + Intronic
1132239213 15:100244726-100244748 CGGCTTGTTCCAACCGGAGCAGG + Intronic
1133505187 16:6404878-6404900 AGGCTTCTTCCTTCCATATCGGG - Intronic
1136233656 16:28902283-28902305 GGGCTTCAACCCACCAGACCTGG + Exonic
1136713578 16:32259427-32259449 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136754333 16:32670004-32670026 AGGTTTCTTTCCACCACAGCTGG + Intergenic
1136813780 16:33200361-33200383 AGGTTTCTTTCCACCACAGCTGG - Intronic
1136820256 16:33310441-33310463 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136826819 16:33366980-33367002 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136831885 16:33465751-33465773 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1137714410 16:50589582-50589604 AGGGTTCATCCCTCCAGAGGTGG + Intronic
1137764308 16:50966223-50966245 AGGCTACTACCTATCAGAGCAGG - Intergenic
1137801511 16:51266302-51266324 GGGCCACTTCCCACAAGAGCAGG - Intergenic
1139935618 16:70568880-70568902 CAGCTCCTGCCCACCAGAGCAGG + Intronic
1140135270 16:72200094-72200116 AGGCTCCATCCCAGCAGGGCGGG - Intergenic
1140888025 16:79261580-79261602 AGGCATCTTTCCCCCAGAGAAGG - Intergenic
1140892226 16:79294989-79295011 AGTCTACTTCCCCCTAGAGCAGG + Intergenic
1141009949 16:80387916-80387938 TGGCTTCTTCCCCCCAGGGCTGG + Intergenic
1141766088 16:86060858-86060880 AGGCTTCTGCCGTCCAGAGGAGG + Intergenic
1142188317 16:88705435-88705457 AGGCTTCCTCCCAACGGGGCTGG + Intronic
1202992356 16_KI270728v1_random:23335-23357 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1203056480 16_KI270728v1_random:930335-930357 AGGTTTCTTTCCACCACAGCTGG + Intergenic
1142738011 17:1913855-1913877 AGACTTCTGGCCTCCAGAGCTGG + Intergenic
1142832089 17:2556804-2556826 AGGCTTCTTGCAACCAGATGTGG + Intergenic
1143162336 17:4879742-4879764 AAGTTTCTTCCCACTAGGGCTGG + Intronic
1143868465 17:9940941-9940963 ATGCTTATGCCAACCAGAGCTGG + Intronic
1146640440 17:34536676-34536698 AGGCTGGCTCCCACCAGAGGAGG + Intergenic
1147136658 17:38437970-38437992 AGCCTTCTTCCCCTGAGAGCTGG - Intronic
1147723039 17:42550348-42550370 AGGCCTCTTCCTCCAAGAGCAGG - Exonic
1147724251 17:42556574-42556596 AGGCCTCTTCCTCCAAGAGCAGG - Intergenic
1148355413 17:46972351-46972373 GGACTTCTTCCCACTATAGCTGG - Intronic
1150286815 17:63959408-63959430 AGGCATCTTCACAGCAGAGATGG - Exonic
1150823648 17:68456752-68456774 AGGTTTCTTCCATCCAGAGCGGG + Intronic
1151443357 17:74147960-74147982 AGGCTTCTTTCCTCCTGGGCAGG - Intergenic
1151658030 17:75504690-75504712 TGGCTTCTGCCCCCCACAGCAGG - Exonic
1158491822 18:57916775-57916797 AGGCTTCTTCCCTTCTGACCAGG - Intergenic
1158495137 18:57948671-57948693 AGGCTTCCTGCCAACTGAGCAGG + Intergenic
1158615668 18:58984156-58984178 ATGGTTCTTCCTACCAGTGCCGG + Exonic
1159550030 18:69885383-69885405 TGGCTTCTTGAAACCAGAGCTGG - Intronic
1160854483 19:1210274-1210296 AGGCTTTTTCCCTGCAGCGCTGG - Intronic
1161559136 19:4961427-4961449 AGTCCTCTGCCCACGAGAGCAGG + Exonic
1161687672 19:5711424-5711446 TGGCTTCTTCCCACCAAGCCTGG - Intronic
1161963934 19:7537571-7537593 GGGTTTCTTCACACCAGGGCAGG + Intronic
1161988874 19:7672728-7672750 AGGCTTTTGCCCACTAGAACAGG - Intergenic
1162780540 19:13004653-13004675 AGGCTTCTACAAACCAGGGCAGG - Intronic
1164622865 19:29707638-29707660 AGGCATCTTTCCCCCAGTGCTGG - Intronic
1166094282 19:40529854-40529876 AAGTTTCTTCCAACCAAAGCTGG + Intronic
1167604919 19:50476520-50476542 CGGCTTCTTCCCACCAGCGAAGG - Exonic
925385446 2:3458728-3458750 ATGCTCATTCCCACCAAAGCAGG - Intronic
925904850 2:8534375-8534397 GGGCTTCTTCCCTGCAGAGAGGG + Intergenic
928229707 2:29487259-29487281 TGGATGCTTCCTACCAGAGCTGG + Intronic
928686850 2:33758992-33759014 AGTATTCTTCCTACCAGAGGGGG - Intergenic
930509492 2:52326677-52326699 AGGCTACTGGCCCCCAGAGCAGG - Intergenic
933178329 2:79201547-79201569 AAGCTTCTTCCAACAAGAGTTGG + Intronic
934587460 2:95514941-95514963 TGCCTTCTTCCCAGCAGAGGCGG - Intergenic
936570036 2:113604884-113604906 AGCCTCCTTCCCACCATACCAGG + Intergenic
936598472 2:113872534-113872556 AGACTTCTAGCCTCCAGAGCTGG + Intergenic
937151408 2:119688908-119688930 AGGCTGCTTTCCACCAGCGATGG + Intergenic
937767693 2:125680508-125680530 AGGCTTCTCCCCACCACCGTTGG + Intergenic
940668620 2:156639900-156639922 CGGCTACTTGCCTCCAGAGCAGG - Intergenic
942567939 2:177285222-177285244 ATCCTTCTTCCCACCAGTGGAGG - Intronic
943387768 2:187223791-187223813 AGGTTACTTCCCAAGAGAGCAGG - Intergenic
944465119 2:199993107-199993129 CTTCTTCCTCCCACCAGAGCAGG - Intronic
946041031 2:216783058-216783080 AGACTTCTAGCCACCAGAACTGG - Intergenic
946770922 2:223087353-223087375 AGCCTTCTACCCAGCAGAGAAGG - Intronic
947338278 2:229110035-229110057 AGGCATCTGCCCAGCAGAGGAGG - Intronic
947530472 2:230905910-230905932 TGGCTTTTTCCACCCAGAGCTGG - Intergenic
947869883 2:233428832-233428854 AGGCTTCTTCACAACAGAACAGG + Intronic
948701976 2:239766290-239766312 AGGCTCCTTCCCACAAAGGCAGG + Intronic
1168998252 20:2148186-2148208 GGGCTTCTTTTCATCAGAGCCGG + Exonic
1169213119 20:3778541-3778563 AAGCTGCTTCCCACCCCAGCTGG - Exonic
1169377672 20:5079588-5079610 AGTCATCTTCCCACCTCAGCTGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1171191689 20:23163532-23163554 GAGCATCTTCCCACCAGAGCAGG + Intergenic
1171946002 20:31378136-31378158 TGCCTTCTTCCCACCAGATAGGG - Intronic
1173815258 20:45983407-45983429 AGCCTTCTTCCCAGCAGAGCTGG + Intergenic
1175910596 20:62403563-62403585 GGGCTTCTGGCCTCCAGAGCTGG + Intronic
1176897938 21:14405318-14405340 AGGCTTGTAGCCAGCAGAGCTGG + Intergenic
1179480087 21:41671489-41671511 AGGCTCCCTCCTACCTGAGCTGG - Intergenic
1179532551 21:42029879-42029901 AGTCTTCATTTCACCAGAGCAGG - Intergenic
1179598935 21:42462565-42462587 AGGATTCTTCCTAGCAGACCTGG - Intergenic
1180582849 22:16857902-16857924 ATGGTTCTTCCTACCAGTGCTGG - Intergenic
1180787170 22:18553558-18553580 GGGCTTCCTACCAACAGAGCTGG - Intergenic
1181011103 22:20041043-20041065 AAGCTTCTTGCCAGCAGAACTGG - Intronic
1181139374 22:20792809-20792831 TGGCTCCTTCCCACAAGTGCAGG - Intronic
1181234570 22:21441748-21441770 GGGCTTCCTACCAACAGAGCTGG + Intronic
1182761404 22:32725202-32725224 GGGTTTCTTTCCACCACAGCAGG + Intronic
1183083359 22:35471512-35471534 ATGCCTCTTCCCACCAGTCCTGG + Intergenic
1183200033 22:36379743-36379765 AGGCTCCTTCCAGCCACAGCAGG + Intronic
1183563726 22:38597541-38597563 TGGCCTCTTCCCTCCAAAGCAGG - Intronic
1183784963 22:40023901-40023923 AGGCTTCTGCCCACCTGGGTGGG + Intronic
1184128335 22:42502666-42502688 AAGCTTCTTCCCACCAGTTGGGG - Intergenic
1184137127 22:42555981-42556003 AAGCTTCTTCCCACCAGTTGGGG - Intronic
1184231398 22:43160115-43160137 GGCCTTATTCCCATCAGAGCCGG - Intronic
1184831842 22:46993831-46993853 AGGCTTCCTGGCCCCAGAGCGGG + Intronic
955214349 3:56972587-56972609 AGGCTTCTCCCTGCAAGAGCCGG + Intronic
955894532 3:63685424-63685446 AGGCTTATTCCCACCACGGTGGG + Intergenic
957060982 3:75481154-75481176 AGACTGCTGGCCACCAGAGCCGG + Intergenic
960049480 3:113226333-113226355 AGACTTCTTTCCACCAGCACTGG - Intronic
961117259 3:124341262-124341284 AGGCTCCTTGCCACTACAGCAGG - Intronic
962154349 3:132929788-132929810 AGACATGTTCCCACCATAGCAGG - Intergenic
962380422 3:134894088-134894110 TGGCTTCTTCCTACCAAAGCAGG + Intronic
965701876 3:171466283-171466305 AGTCTTCTTCCTACCAGGGTGGG + Intergenic
968592638 4:1466513-1466535 AGGGTTCTCCCCACCCGGGCCGG - Intergenic
969544801 4:7818704-7818726 AGGTCTCTTCCCAGCAGACCAGG - Intronic
971139256 4:23906046-23906068 AGGCTTCTTTTGATCAGAGCAGG - Intergenic
979859008 4:125670236-125670258 AGGTTTCTTCCCAGTACAGCAGG - Intergenic
981238290 4:142443658-142443680 AGGCTACCTCCCACCAGAGGGGG + Intronic
984402391 4:179283029-179283051 AGGCCAGTTCCCACCACAGCGGG - Intergenic
985393213 4:189513879-189513901 TGGCTTCTTTACACAAGAGCCGG + Intergenic
985657389 5:1139318-1139340 GGGCTGCTCCCCACCAGGGCTGG - Intergenic
985832289 5:2242653-2242675 AGGCTCCCTCACACCAGAGGGGG + Intergenic
990404388 5:55473799-55473821 AGGCTCCTGCCCACCATACCTGG + Intronic
990506839 5:56453765-56453787 AGAATTCTGCCCACCACAGCTGG + Intergenic
993601075 5:89925515-89925537 AGCCTTCTTCCCATCAGAGGTGG - Intergenic
996318000 5:122182920-122182942 AGGCTGCTTCTCATCAGAGCTGG + Intergenic
997288267 5:132699994-132700016 AGGCTTATTCCCACCACAAGAGG - Intronic
997720104 5:136071235-136071257 AGCCTTCTTCACTCCAAAGCTGG - Intergenic
997856494 5:137377427-137377449 AGGCTTCTTCCCTTGAGAGGAGG - Intronic
998849035 5:146337398-146337420 AGTCTTTTTCCCACCATCGCAGG + Intronic
999201682 5:149821059-149821081 AGTCTTCTTGCCTCCAGAGCCGG + Intronic
999212631 5:149903546-149903568 AGGCTGCTTCCCAGCAGAGTGGG + Intronic
999826100 5:155275126-155275148 AGGCCTCATCTCTCCAGAGCAGG + Intergenic
1002093009 5:176815783-176815805 ATGCTTCTTCCAACCAGAAGGGG - Intronic
1002458765 5:179362005-179362027 GGACTTCTGCCCTCCAGAGCGGG - Intergenic
1002839544 6:893992-894014 AGGCTGCTTCCTACCTGAGTCGG - Intergenic
1003534582 6:6965524-6965546 AGGCTTCCTCACACTACAGCTGG - Intergenic
1004811497 6:19268965-19268987 TGGCTTCTGGCCCCCAGAGCAGG - Intergenic
1004897503 6:20162878-20162900 AAGCTTCTTTCCATCAGTGCTGG + Intronic
1005054765 6:21719230-21719252 GGACTTCTTCCCTCCAGAACTGG - Intergenic
1005358759 6:25010268-25010290 TCCCCTCTTCCCACCAGAGCTGG + Intronic
1007226597 6:40319871-40319893 AGGCTCCTTCCCCATAGAGCAGG - Intergenic
1011440375 6:87380849-87380871 AGGCATCCTCCCACCTCAGCAGG + Intronic
1011777731 6:90750493-90750515 AGGCTTCTTCCTTCCAGGCCTGG + Intergenic
1017983696 6:159424432-159424454 AGACTTCTGCCTTCCAGAGCTGG - Intergenic
1018268547 6:162051688-162051710 AGGCTTCTTCCCATCAGCCCTGG - Intronic
1018465197 6:164037894-164037916 AGGCTTATTAGCACCAGGGCAGG + Intergenic
1018659504 6:166073251-166073273 TGGCTTCTTCCCACCTCACCTGG + Intergenic
1019275883 7:175346-175368 AGGCCTGTTCCTCCCAGAGCTGG - Intergenic
1021155096 7:17200221-17200243 ATGCTGCTTCCAACCACAGCAGG + Intergenic
1024055948 7:45659928-45659950 AGGCTTCCCCACACCAGGGCAGG - Intronic
1028699664 7:93762566-93762588 GGGTTTCTTCCCACTAGATCTGG + Intronic
1029819089 7:103128080-103128102 AGGCTACTACCTTCCAGAGCAGG + Intronic
1032433815 7:131883981-131884003 AGGGCTCTTCCCATCACAGCAGG - Intergenic
1033462067 7:141555714-141555736 AGACTTCTTGTAACCAGAGCTGG + Intronic
1034364914 7:150537884-150537906 AGGCTTCTGCCCACAAGCCCAGG + Intergenic
1034637559 7:152579404-152579426 AGCCTTCTTCCCAGCAGGGATGG - Intergenic
1035470814 7:159107550-159107572 AGTCCTCTTCCCACCCGGGCTGG - Intronic
1036509704 8:9388931-9388953 AGACTTCTGGCCTCCAGAGCTGG + Intergenic
1036758329 8:11486641-11486663 AGGCCTTTTCCTACCAAAGCTGG + Intergenic
1036945458 8:13090582-13090604 AGGCATCTTCCCGCCGGAGGTGG + Intronic
1037944055 8:22975399-22975421 TGACTCCCTCCCACCAGAGCTGG + Intronic
1038223501 8:25633065-25633087 AGGCTTATTACCAACAGAGGTGG + Intergenic
1040011515 8:42664953-42664975 AGGGTGCCTCCCAGCAGAGCGGG - Intergenic
1040594231 8:48822141-48822163 AGGCTTCCTGACACCAGAGCTGG + Intergenic
1042599165 8:70481044-70481066 TGGCTTCTTCCCACCAGCTGTGG + Intergenic
1043053411 8:75408134-75408156 CGCCTTCTTCCCTCCAGCGCAGG - Intronic
1044628829 8:94260130-94260152 GGGCTTCTTTCCACCAGGGGTGG - Intronic
1048315389 8:133358055-133358077 AGGCTCCTCCCCACCATGGCTGG + Intergenic
1049748978 8:144274694-144274716 CGGCTTCCTCCCAGCACAGCAGG + Intronic
1050018254 9:1258679-1258701 ATGCTTCTGCCCATCACAGCTGG + Intergenic
1051523406 9:18015711-18015733 AAGCTTCTTCCCACAAGACCAGG + Intergenic
1055719178 9:79152643-79152665 AAGCTTGTTTCCCCCAGAGCTGG + Intergenic
1056687955 9:88782349-88782371 AGGCTTCGGCAGACCAGAGCTGG + Intergenic
1057302302 9:93893969-93893991 ATGCGTCCTCCCAGCAGAGCGGG - Intergenic
1057397128 9:94690131-94690153 AGGCTTCTGTCCTCCAGAACTGG + Intergenic
1061118561 9:128629396-128629418 AGGCTTCCTCCTACCCCAGCAGG - Intronic
1061889002 9:133607925-133607947 AGGGCTCTACCCACCTGAGCAGG - Intergenic
1061934451 9:133849619-133849641 AGGCTTCTGGCCTCCAGAACTGG - Intronic
1062095557 9:134701453-134701475 AGGCTTCTGACCAACAGAGACGG - Intronic
1062653215 9:137589264-137589286 AGGCTTTTTTCCACCAGGGAAGG - Intronic
1188837664 X:34978362-34978384 TGGCTTCTTGCCAGCAGCGCAGG - Intergenic
1189868241 X:45353764-45353786 GGACTTCTTCCAACCAGAACTGG + Intergenic