ID: 901363783

View in Genome Browser
Species Human (GRCh38)
Location 1:8727790-8727812
Sequence CTTTAAGAATAGTGGGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901363783_901363787 -1 Left 901363783 1:8727790-8727812 CCAATTACCCACTATTCTTAAAG 0: 1
1: 0
2: 1
3: 8
4: 171
Right 901363787 1:8727812-8727834 GGTCAGCAGTACTTCCCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 128
901363783_901363788 4 Left 901363783 1:8727790-8727812 CCAATTACCCACTATTCTTAAAG 0: 1
1: 0
2: 1
3: 8
4: 171
Right 901363788 1:8727817-8727839 GCAGTACTTCCCCAAAGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901363783 Original CRISPR CTTTAAGAATAGTGGGTAAT TGG (reversed) Intronic
901363783 1:8727790-8727812 CTTTAAGAATAGTGGGTAATTGG - Intronic
903775796 1:25792867-25792889 ATTTAAGAATAGTGCGTTTTAGG - Intergenic
906799132 1:48720889-48720911 CTTTAGGAATAGATGGTAACAGG + Intronic
908280442 1:62528364-62528386 TTTAAAGAATAGTGGAGAATAGG - Intronic
909790046 1:79665542-79665564 TTTTAAGAATAGCAGGTACTGGG + Intergenic
909957074 1:81791323-81791345 GTTTGAGTATTGTGGGTAATTGG + Intronic
911158820 1:94662409-94662431 CTTTAATAAAATTGGGGAATTGG - Intergenic
911891152 1:103373590-103373612 CTTTAATTAAAGTGGGTATTGGG - Intergenic
913586936 1:120284600-120284622 CTTTAAGAAATGTGGATGATGGG + Intergenic
913621249 1:120613770-120613792 CTTTAAGAAATGTGGATGATGGG - Intergenic
915996622 1:160570563-160570585 CTTTAAGAAGAGTGGGAACCTGG + Intronic
917075564 1:171200873-171200895 CCTTAGGAACAGTGTGTAATGGG + Intronic
920610777 1:207435273-207435295 TTTTAAGAAGAGTGGCTTATGGG + Intergenic
921369949 1:214411852-214411874 ATTTAATAATAGTGAGAAATAGG - Intronic
924082603 1:240414877-240414899 TTTTAAGACAAGTGGGAAATAGG + Intronic
1066028155 10:31386453-31386475 CCTTAAGAATATTGACTAATCGG + Intronic
1066208216 10:33210681-33210703 CCCCAAAAATAGTGGGTAATGGG - Intronic
1072181254 10:92983107-92983129 CTTTCACAATAGCGGTTAATTGG - Intronic
1072184558 10:93023619-93023641 ATTTCAGAATAGGGGGTAACAGG - Intronic
1072348472 10:94532819-94532841 ATTTCAGAATAGTTGGCAATTGG + Intronic
1073030608 10:100522814-100522836 CCTTAATAATAGTGGTTACTTGG - Intronic
1073574060 10:104606821-104606843 TTTGAAGGATCGTGGGTAATTGG - Intergenic
1074634622 10:115300561-115300583 TTTTAAGATTAATGGCTAATTGG + Intronic
1076167387 10:128293463-128293485 TTTTAAGGATAGTAGGAAATAGG + Intergenic
1077665517 11:4105183-4105205 CTTTCAGAATGGTGGGCAGTGGG - Intronic
1078878198 11:15419498-15419520 TATGAAGATTAGTGGGTAATGGG + Intergenic
1079337681 11:19585683-19585705 CTTTAAGAATGTTGAATAATTGG + Intronic
1079904575 11:26229788-26229810 CAATTTGAATAGTGGGTAATTGG - Intergenic
1081059172 11:38451296-38451318 CTATAAGATTAGTGGGGAAATGG + Intergenic
1081067119 11:38557626-38557648 CTTTCAGAATATTGTGTACTTGG + Intergenic
1081342296 11:41943181-41943203 ATTCAAGAATAGTGAGTATTGGG - Intergenic
1083863199 11:65437133-65437155 CTTAAAGATTAGTGAGAAATAGG - Intergenic
1085882858 11:80488358-80488380 CTTGAAGAAGGGTGGGTAAAGGG + Intergenic
1086140376 11:83492378-83492400 CTTTAAAAATTGGGGGTATTTGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1097351299 12:58552025-58552047 CTTTAATAACTGTGGTTAATGGG - Intronic
1098226092 12:68326513-68326535 CTATAAGAATAGTTGATAACAGG - Intronic
1098966736 12:76798408-76798430 CTTTAAGAATTGTCTGAAATTGG + Intronic
1100942335 12:99737870-99737892 ATTGATGAATAGTTGGTAATTGG - Intronic
1102047116 12:109836208-109836230 CTTTAAAAATACTGGTTGATGGG + Intergenic
1104533028 12:129590405-129590427 CAATATGAAAAGTGGGTAATTGG - Intronic
1107002902 13:35571339-35571361 CTTGAACAATAGTGGGAATTGGG + Intronic
1107429617 13:40328537-40328559 ATTTAAGAATATGGGGAAATGGG + Intergenic
1109956746 13:69578570-69578592 CTTAAAGAATAGCAGGTAATAGG - Intergenic
1111379272 13:87425181-87425203 CTTTAAGAAAATGGGGTAAAGGG + Intergenic
1111628150 13:90815039-90815061 CTTTAAGAATGTTGAGTATTGGG - Intergenic
1112149439 13:96741125-96741147 CTTTTAGAAAAGTGTATAATTGG + Intronic
1112557150 13:100479078-100479100 CTTTAATAAAAGTGAGTAGTGGG - Intronic
1114324968 14:21579543-21579565 TTTTATAAATAGTGGCTAATAGG - Intergenic
1114479356 14:23022531-23022553 CTTTAATTATAGTGGGCAAGAGG - Intronic
1116155786 14:41203307-41203329 CTTAAATAATAGTGTGGAATGGG + Intergenic
1116564370 14:46427022-46427044 CCTTAAGAATAGAGGATATTGGG - Intergenic
1120424984 14:84336137-84336159 CTTTAAGACTAGTGGAACATAGG - Intergenic
1125081878 15:35684207-35684229 TTTTAAGAATAGTCTGTAAATGG + Intergenic
1125667286 15:41441269-41441291 CTATAAGAATAGTGGGAGAGAGG - Intronic
1126774469 15:52088206-52088228 CTTTGAGAATAGAGGGTGATGGG - Intergenic
1128013767 15:64323663-64323685 TTTTAAGTATAGTCAGTAATTGG - Intronic
1129897292 15:79117819-79117841 CTTTAACAACAATGGGTAAAGGG + Intergenic
1131664404 15:94555229-94555251 CTCTAAGAGTAGTGAGTAAAGGG + Intergenic
1139379726 16:66522890-66522912 CTTTAAGGATACTGTGTAACTGG + Intronic
1144418005 17:15069934-15069956 CTTTGGGTATAGTGGGGAATAGG - Intergenic
1144421238 17:15101088-15101110 CTTTAAGAAGACTGGGAATTTGG - Intergenic
1145389740 17:22446256-22446278 TTTAAAGAATAGTTGGTATTTGG - Intergenic
1146967065 17:37040970-37040992 CTCTAAGAAAAGTAGGTGATAGG - Intronic
1148585552 17:48776749-48776771 CTTTAACAATAGTGAATATTTGG - Intronic
1149689691 17:58564730-58564752 CTTTAGGAATAGGGGCTATTAGG + Intronic
1153216061 18:2821974-2821996 GTTTCAGGACAGTGGGTAATAGG + Intergenic
1153290069 18:3492403-3492425 CTAGAAGAATAGTTGGTCATTGG + Intergenic
1155275557 18:24184124-24184146 CTTTAAGAATATAGGCAAATAGG + Intronic
1155413177 18:25568608-25568630 GTTTAAGAATAGTCAGTCATAGG + Intergenic
1156598597 18:38576911-38576933 TTCTGAGAATAATGGGTAATAGG + Intergenic
1156818349 18:41339959-41339981 CTTGGAGAATATTGAGTAATAGG + Intergenic
1157671728 18:49535606-49535628 CTTTAATAAAATTGGGAAATTGG + Intergenic
1158383215 18:56959033-56959055 CGTTAAAAATAATGGGTAAAAGG + Intronic
1158531894 18:58270216-58270238 ATTTCAGAGAAGTGGGTAATAGG + Intronic
1162775400 19:12975826-12975848 CTTTAAGAATTGTGGAGACTGGG - Intergenic
927277996 2:21278113-21278135 CTGTAAAAATAGAGGGCAATAGG - Intergenic
928221712 2:29408717-29408739 TTTTTAGAAAAGTGGGGAATGGG + Intronic
931068110 2:58610831-58610853 CTTTCAGAATATTGGGAAAATGG + Intergenic
931740978 2:65243768-65243790 CTTCATGAAAAGTGGGTAGTAGG - Intronic
931937672 2:67216028-67216050 CTTTAAGAATAATAGTTTATAGG - Intergenic
933370081 2:81403596-81403618 CATTTAGAAGAGTTGGTAATAGG + Intergenic
933381194 2:81548218-81548240 CTTTAAGAATGGTTGGAATTTGG - Intergenic
933824585 2:86147468-86147490 CTTTAAGGAGAGTTGGTAAAGGG - Intronic
938554520 2:132412298-132412320 CCTTAAGAATAATGAGTATTAGG - Intergenic
942192925 2:173488713-173488735 CTATAGGAATAGTGTGTAAAAGG - Intergenic
942470194 2:176251903-176251925 CTTTAAGAATAGGTGGGAGTTGG + Intergenic
943130156 2:183843714-183843736 CTTTAAGAATGCTGGATATTGGG - Intergenic
944652282 2:201843063-201843085 CTTTAAGAATAGTCTGTGGTGGG + Intronic
945685761 2:212967755-212967777 CTTTAAAAATAGTAGGGGATGGG + Intergenic
1169953232 20:11071849-11071871 CTTCAAGAAGATTGGGTGATCGG - Intergenic
1170279363 20:14628056-14628078 CTTTAAGATAAGTAGGAAATAGG + Intronic
1174297188 20:49556683-49556705 CTTTAATAAAATTGGGGAATTGG + Intronic
1178179701 21:30145681-30145703 CTGTAAAAATAGTGTGTAAGAGG - Intergenic
1178463758 21:32827144-32827166 CTTCAAGAATATTGGGGAAGAGG + Intergenic
1179133975 21:38662953-38662975 CTTGAAAATTAGTGGCTAATTGG - Intergenic
950868927 3:16212507-16212529 CTTTAAGAACGGCGGGAAATAGG - Intronic
950989921 3:17422491-17422513 TTTTAAGAATATTGGCTCATTGG - Intronic
952765723 3:36952477-36952499 CTATTAGAAAAGTGGGAAATGGG - Intergenic
958041592 3:88232443-88232465 CATAGAGAATAGTGGGGAATTGG + Intergenic
959224721 3:103564798-103564820 CTTTAAAGATGGTGGGTCATCGG - Intergenic
960072827 3:113451231-113451253 ATTCAAGAATAGTTGGTGATTGG + Intronic
961700382 3:128739766-128739788 CTTTAAGAAAAGTATTTAATAGG + Intronic
963389098 3:144634663-144634685 CTTTAAGAATGGTGTATAACTGG - Intergenic
963652749 3:148004137-148004159 ATTTAAGTATAGTGGTTAGTTGG - Intergenic
964449354 3:156796115-156796137 CCTTCAGAATAGTGTGTGATTGG + Intergenic
964969817 3:162545727-162545749 CTTTATTAATAGTGGGTAGAAGG - Intergenic
965016362 3:163163081-163163103 ATTTAAAAATAGAGTGTAATTGG - Intergenic
965244962 3:166255779-166255801 CAATAAGAATAGTGGTGAATTGG + Intergenic
967814634 3:193788451-193788473 CTTTAAGAAGAATGGGGAAGGGG - Intergenic
967913642 3:194562233-194562255 CTTTAAGAATATTTGGCACTAGG - Intergenic
969995567 4:11308787-11308809 CTTCTAGAATGGTGGGTAGTTGG + Intergenic
973913852 4:55612747-55612769 CTTGAAGAATAGTTGAGAATTGG - Intronic
974909272 4:68096655-68096677 TTTTAAAAACAGTGGATAATTGG + Intronic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
977271880 4:94927022-94927044 ACTTAAGAATTGTGGGTAAATGG - Intronic
979927496 4:126585207-126585229 CTTTAAGAATACTGAAAAATAGG - Intergenic
981485046 4:145277067-145277089 TTTTAAGAATAGTTTGTATTAGG - Intergenic
982014459 4:151139450-151139472 CTTTCAAAATAGTGGGTACTAGG - Intronic
982414691 4:155115813-155115835 CTTTAATAAAAATGGGCAATTGG - Intergenic
984363294 4:178765802-178765824 ATTTAAGGATAGTGGCTAATAGG + Intergenic
987034471 5:14006099-14006121 CTTTTTGAATAATGGGTGATGGG - Intergenic
990992723 5:61701252-61701274 CTTTCAGAAGAGTGGGGAAGGGG + Intronic
992086599 5:73283417-73283439 TTTGAAGAACAGTGGGCAATAGG - Intergenic
995747653 5:115420536-115420558 CTTTAAAAATATTGGGGAGTAGG - Intergenic
996287703 5:121813886-121813908 CTATAAGAATAGAAGGTAAAGGG - Intergenic
999063261 5:148657633-148657655 CTTTTATAAGAGTGGGTACTTGG + Intronic
999528537 5:152435844-152435866 ATTTAAGAATAATGGAAAATTGG + Intergenic
1000219614 5:159200503-159200525 CTGTATGAATAGTGTGTTATAGG - Intronic
1000402810 5:160849981-160850003 CTTTAAGGAGAGTGGGTAAATGG + Intronic
1000455932 5:161448805-161448827 CTTTAAGAATAATAGATAAAAGG + Intronic
1001442394 5:171753891-171753913 CTTTACGGGTAGTGGGTAGTGGG - Intergenic
1002940026 6:1707717-1707739 CTTTCAGAAGAGTGGGTGAGTGG - Intronic
1004352895 6:14906008-14906030 CTTTATGAATAAATGGTAATGGG + Intergenic
1005981059 6:30836867-30836889 CTTTATGAAAAGTGGGGCATGGG + Intergenic
1006684797 6:35823690-35823712 TTTTATGAAGAGTGGGTGATAGG + Exonic
1006843810 6:37049137-37049159 CTTTGACAATCGTGGGAAATTGG + Intergenic
1007627494 6:43254713-43254735 CTGTAAGAAAAGTGGGTGAAGGG - Intronic
1009321845 6:62300775-62300797 CTATAATAATAGTGGGTAAAAGG + Intergenic
1009442982 6:63704468-63704490 TTTTCAGAATATTGTGTAATTGG + Intronic
1009496466 6:64354689-64354711 CTTTAAGAAATATGTGTAATGGG + Intronic
1009718963 6:67440026-67440048 CAATAAGAAGAGTGGGTCATTGG + Intergenic
1010983681 6:82398169-82398191 ATTTAAGAACATTGGCTAATGGG - Intergenic
1011029094 6:82901800-82901822 CTTTATTAATATTGGGAAATAGG - Intronic
1011122611 6:83970216-83970238 CTTTAATAAAATTGGGGAATTGG - Intergenic
1012711845 6:102616968-102616990 CTTGGAGAAAAGTCGGTAATAGG - Intergenic
1014441241 6:121476494-121476516 TTTTAAGAATAGTGGTAACTGGG + Intergenic
1015043419 6:128749029-128749051 TTTTAAGAATAGTATGTGATTGG - Intergenic
1018861120 6:167711542-167711564 CTTTATAAATAGTGGGTTACAGG - Intergenic
1019116923 6:169772463-169772485 TTTTAAGAATTGTAGGTAGTGGG + Intronic
1021389085 7:20069621-20069643 CTTTAAGAATGTTGAATAATTGG - Intergenic
1024464445 7:49696800-49696822 CTTTAAAAAAAATAGGTAATTGG + Intergenic
1026431665 7:70353606-70353628 CTTTATGAACAGTGGGTAATGGG - Intronic
1031375499 7:121020031-121020053 CTTGAAGAGTAGTGGATATTTGG + Intronic
1033641958 7:143269766-143269788 CTTTAAGAATACTCTGTATTTGG + Intronic
1037804591 8:22051970-22051992 CTTTAAGAATACTGGAAAACTGG + Intronic
1038083303 8:24164546-24164568 CTTTGAGAATCATGGATAATTGG + Intergenic
1039350599 8:36759641-36759663 TTGTGAGATTAGTGGGTAATTGG + Intergenic
1042098800 8:65249543-65249565 ATTTCAGAATAGTGGTTACTTGG - Intergenic
1042482525 8:69320015-69320037 CTTTAAGCAGGGTGGGTTATGGG - Intergenic
1043562158 8:81506019-81506041 CTCTAATACCAGTGGGTAATAGG - Intergenic
1047172989 8:122512500-122512522 GATTAAGACTAGTGGGTCATAGG + Intergenic
1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG + Intergenic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1050193362 9:3053690-3053712 ATGTAAGAATTGTGGGCAATGGG - Intergenic
1051937537 9:22461185-22461207 CTTGGAGAAAAGTGGGTAAAAGG - Intergenic
1052432465 9:28384527-28384549 TTTTAAAAATAGTGGGAAAAAGG - Intronic
1053385937 9:37688612-37688634 CTTTCATAATAGTGAGAAATTGG + Intronic
1059076539 9:111199002-111199024 CTTTAAGAATGTTGAATAATTGG - Intergenic
1060171625 9:121466218-121466240 CTTTAAAAATTGGGGATAATAGG - Intergenic
1185756564 X:2658145-2658167 TTTTAAGAAGTGTGGTTAATGGG + Intergenic
1188264534 X:28055202-28055224 TTTTAAGTATAGTGGATGATGGG - Intergenic
1188477723 X:30604973-30604995 CTCTAAGTATAGTGGATTATTGG - Intergenic
1188782549 X:34303346-34303368 ATTTCAGAATGGTGGGTGATGGG - Intergenic
1188889153 X:35588318-35588340 ATTTAAAAATAGTGTGTCATGGG + Intergenic
1190844383 X:54178058-54178080 CTTTAAGAATAATGGTGAATAGG + Intronic
1193075368 X:77349326-77349348 CTTTAAGAATGTTGAATAATTGG - Intergenic
1193458221 X:81756652-81756674 CTTTAAGAATATTGAATATTGGG - Intergenic
1196012353 X:110902668-110902690 CTTTAAGAATATTGAATATTGGG + Intergenic
1198800280 X:140440591-140440613 ATTTAAGAATAGTTGGTTACGGG - Intergenic
1201453702 Y:14145038-14145060 TTTTAAGAATAGTGTTAAATAGG + Intergenic