ID: 901363786

View in Genome Browser
Species Human (GRCh38)
Location 1:8727798-8727820
Sequence CTGCTGACCTTTAAGAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901363786_901363788 -4 Left 901363786 1:8727798-8727820 CCACTATTCTTAAAGGTCAGCAG 0: 1
1: 0
2: 1
3: 15
4: 133
Right 901363788 1:8727817-8727839 GCAGTACTTCCCCAAAGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 83
901363786_901363787 -9 Left 901363786 1:8727798-8727820 CCACTATTCTTAAAGGTCAGCAG 0: 1
1: 0
2: 1
3: 15
4: 133
Right 901363787 1:8727812-8727834 GGTCAGCAGTACTTCCCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901363786 Original CRISPR CTGCTGACCTTTAAGAATAG TGG (reversed) Intronic
900942618 1:5810779-5810801 CTCCAGAGCTTTAAGAAGAGGGG - Intergenic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
904925628 1:34045703-34045725 CTGCTGAGGTCTAAAAATAGGGG + Intronic
906605150 1:47164097-47164119 ATGCTGACCTTGAAGATTGGAGG - Intergenic
907563293 1:55410925-55410947 CAGCTGACCTTAAAGGAGAGTGG + Intergenic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
911493791 1:98604103-98604125 CTGGTGTCCTTTCAGGATAGGGG - Intergenic
912901457 1:113654316-113654338 ATGCTGACTTTTAAGAAAATGGG + Intronic
913292535 1:117287312-117287334 GTGCTGAACGTTAAGAATACAGG + Intergenic
913692368 1:121291249-121291271 CTGGTGACCTAGAAGAATTGTGG + Intronic
914145189 1:144988853-144988875 CTGGTGACCTAGAAGAATTGTGG - Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
920479688 1:206309606-206309628 CTGGTGACCTAGAAGAATTGTGG + Intronic
920690577 1:208143473-208143495 ATGCTGACCTCAAAGAAAAGAGG + Intronic
921033671 1:211356077-211356099 CTCCTGACCTTTAAGAATGTGGG + Intronic
922539171 1:226406212-226406234 CTGCTTACATTTATGATTAGAGG + Intronic
923952226 1:238969910-238969932 CTGCTGACCGATTAGAATAGTGG + Intergenic
924829664 1:247579654-247579676 CAGCTGGCTTGTAAGAATAGTGG + Intergenic
1064304327 10:14151822-14151844 CTGCTGCCCTTTAAAAACAAAGG - Intronic
1066640326 10:37548883-37548905 AAGCTCACCTTTCAGAATAGGGG + Intergenic
1067408726 10:46046484-46046506 CTGCTGACCTAAAAGAGCAGAGG + Intergenic
1068025115 10:51633047-51633069 CTGATTAGCTTTAAGCATAGTGG - Intronic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1076021432 10:127076936-127076958 CTGCAGGCCTTTGAGAACAGAGG + Intronic
1076395321 10:130134734-130134756 CTCCTGCCCTTTAAGAACACAGG + Intergenic
1077058384 11:607006-607028 CCACTGACATTTAAGAAGAGTGG + Intronic
1078293425 11:10040011-10040033 CTGCTGACTGCTAAAAATAGAGG + Intronic
1079930798 11:26557504-26557526 CAGCTTGCCTTTATGAATAGAGG - Intronic
1080265965 11:30402161-30402183 ATGCTGAGCTTTAAAAACAGTGG + Intronic
1080306505 11:30842829-30842851 CTACTGATTTTTAATAATAGTGG + Intronic
1081432750 11:42994514-42994536 CTGATGACATTAAAGAATAATGG - Intergenic
1086334639 11:85787790-85787812 CTACTGGCCTCTAAGAATGGTGG + Intronic
1087667271 11:101065158-101065180 TTGCTGCCCTGTAAGGATAGGGG + Intronic
1087783908 11:102332547-102332569 CTTCTGAGCTTTATGAATATTGG - Intronic
1087941027 11:104097429-104097451 CAGATGAACTTTAAGAACAGAGG - Intronic
1094329544 12:29275926-29275948 CTGTTGACTTTTATGAACAGTGG + Intronic
1099314856 12:81071339-81071361 ATGCTGACCATTTAAAATAGTGG + Intronic
1099347948 12:81526188-81526210 ATGCTGACATTTGAGATTAGGGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102948904 12:117015064-117015086 CTGCCGTCCTCAAAGAATAGGGG - Intronic
1104093562 12:125536117-125536139 CCTCTGACCTTTAAGAATGAAGG + Intronic
1104185950 12:126431525-126431547 CTGATGACCTTAAAAAATACAGG + Intergenic
1105465868 13:20639475-20639497 CTGCCAACCTTGAAGAATAGGGG + Intronic
1107174326 13:37382371-37382393 ATGCTGACATTTGAGAATAGTGG - Intergenic
1107579191 13:41764051-41764073 CAGTTGACGGTTAAGAATAGGGG - Intronic
1109352374 13:61200934-61200956 ATACTGTCCTTTAAGAATTGGGG - Intergenic
1109869052 13:68306836-68306858 TTGATGACCTTTAATAATCGTGG - Intergenic
1109947973 13:69462939-69462961 CTCCTGTTCTGTAAGAATAGGGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110664847 13:78105013-78105035 TTGTTGAACTTCAAGAATAGAGG + Intergenic
1111645178 13:91023300-91023322 CTGTCGATCTTTAAGAAGAGGGG + Intergenic
1111894201 13:94120423-94120445 AACCTGGCCTTTAAGAATAGAGG - Intronic
1112978041 13:105345419-105345441 CTGCAGACATTAAAGAATACTGG - Intergenic
1113744429 13:112733257-112733279 CTGCTCATCTTTAAGTAAAGTGG - Intronic
1116477255 14:45355112-45355134 CTGCTGACTTTTAAAAAGATTGG + Intergenic
1118912653 14:70074591-70074613 CTTCAGACCTTTAAGCATAGAGG - Intronic
1120811154 14:88804561-88804583 ATGCTGCCCTGTAAGAATTGGGG - Intergenic
1125312377 15:38394072-38394094 GTGTTGTCCTTTAACAATAGTGG - Intergenic
1126652184 15:50935708-50935730 CTGCGGACCTTTAAGAACAATGG + Intronic
1126774473 15:52088214-52088236 GTACTGTCCTTTGAGAATAGAGG - Intergenic
1127926338 15:63547210-63547232 CTGTTTTCCTTAAAGAATAGCGG + Intronic
1130362439 15:83203193-83203215 TTTCTGACCTTTTAGAGTAGGGG + Intronic
1134890360 16:17836293-17836315 GTGCTGTCCTGTAAGATTAGGGG - Intergenic
1137567742 16:49543889-49543911 CTGCTGATCTGTAAAAACAGAGG + Intronic
1139715821 16:68812166-68812188 CTGCTGACCTTCAAGGTGAGGGG + Exonic
1140111176 16:72006478-72006500 CTGCTGACCTTGAAGAAACTGGG - Intergenic
1141804205 16:86332020-86332042 CTGCTGACTTTGAAGATTAAGGG - Intergenic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143902538 17:10184865-10184887 CTGCTGACCTCCAGGAAAAGGGG + Intronic
1146029787 17:29355923-29355945 CTGCTGACCCTTAATATTAATGG + Intergenic
1149576331 17:57716027-57716049 CTGCTCCCCTTTAAGAAGAGAGG - Intergenic
1150037562 17:61820467-61820489 TTGCTGTCCTGTAAGAATACAGG - Intronic
1152578546 17:81154935-81154957 ATGCTGACCATTTAAAATAGTGG - Intronic
1153304458 18:3619405-3619427 CTGCTGACCTGCAAGTCTAGTGG + Intronic
1164509578 19:28886333-28886355 CTGTTGACCTTTACAAAAAGGGG - Intergenic
925186721 2:1852009-1852031 CTGCTGAGCTTTAAGAATGAGGG - Intronic
925673393 2:6335307-6335329 ATGCTAACATTTAAGTATAGTGG + Intergenic
927375214 2:22405424-22405446 CTGCTGACCATTAAGGAAAAGGG + Intergenic
929081127 2:38123428-38123450 CTGCTGTCCCTCCAGAATAGAGG - Intergenic
929401045 2:41582146-41582168 CTCCAGACCTTCAAGAATGGAGG - Intergenic
930426029 2:51213731-51213753 CTTATGACCTTTACTAATAGTGG - Intergenic
938550871 2:132381164-132381186 GTGCTGTCCTCTAGGAATAGGGG + Intergenic
938562418 2:132485324-132485346 CTGCTGACCAGTCAGGATAGTGG + Intronic
940694245 2:156959298-156959320 CTGCTGAGCTATCAGCATAGAGG + Intergenic
941740403 2:169029310-169029332 CTGCTGACATTTAAAAATGTAGG + Intronic
941938289 2:171004396-171004418 CAGCTGACCTTGAATAATATAGG - Intronic
944141075 2:196457945-196457967 ATGGTGACTTTTAAGAATTGTGG - Intronic
946257413 2:218455187-218455209 ATGCTGATTTTTAAGAATAGAGG + Intronic
946744615 2:222833087-222833109 CTGGTGTCCTTATAGAATAGAGG + Intergenic
1169025711 20:2369634-2369656 CTGCTGATATTTAAAAGTAGGGG + Intergenic
1178825274 21:36010252-36010274 CTTTTTACCTTTTAGAATAGAGG + Intergenic
1181882722 22:25993708-25993730 CTGCTGACCTTTGGGACTTGTGG + Intronic
950929824 3:16777345-16777367 CTGCTGAGATTTAAGAATCCTGG + Intergenic
952754988 3:36858085-36858107 CTGCTGTCCCCTAAGAAGAGTGG - Intronic
953708279 3:45247532-45247554 CTCCTGACTTTTAACAACAGAGG + Intergenic
960335889 3:116417119-116417141 CTCCTGAACTTTAAGTATTGAGG - Intronic
970142661 4:12998907-12998929 CTGCTGCCTTTTCAGAACAGAGG - Intergenic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
976560859 4:86498958-86498980 CAGGTGAGCTTTAAGAAGAGAGG - Intronic
976801641 4:88998987-88999009 CTAATAACCTCTAAGAATAGAGG - Intronic
984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG + Intergenic
984438934 4:179740933-179740955 CAGCTGATGTTTAAGAATAAAGG + Intergenic
985885543 5:2674918-2674940 CTGGTGACCTGTATGAACAGGGG + Intergenic
990180029 5:53150654-53150676 ACGCTGAGCTTTAAGAACAGTGG - Intergenic
992675873 5:79105971-79105993 CTTCTGAACTTCAAGAATAGAGG - Intronic
992822528 5:80511911-80511933 ATGCTGACCATTTAAAATAGTGG - Intronic
993632428 5:90302298-90302320 TTTGTGACCTTTAAGCATAGAGG - Intergenic
994870124 5:105337343-105337365 CTGCTGACTGATGAGAATAGTGG + Intergenic
994894943 5:105691259-105691281 ATGCTGCATTTTAAGAATAGAGG - Intergenic
995668792 5:114575887-114575909 CAGCCAACTTTTAAGAATAGAGG - Intergenic
998518049 5:142773080-142773102 CAGGTGACCTCTAAAAATAGAGG + Intronic
998900775 5:146851362-146851384 GTGCTCACCTTCAAGAAGAGAGG + Intronic
1006933582 6:37702171-37702193 GTCATGACCTTTAAGATTAGAGG + Intergenic
1007729075 6:43934934-43934956 CTGCTTTCCTTTAAGAATAGGGG - Intergenic
1008495700 6:52131954-52131976 ATGCTAAGCTTCAAGAATAGGGG - Intergenic
1012842686 6:104349818-104349840 CAGCTGTCATTCAAGAATAGTGG + Intergenic
1013382019 6:109582889-109582911 CTGCTGACCGATAAGGGTAGTGG - Intronic
1013886010 6:114968186-114968208 ATGCTGACATTTTAAAATAGTGG - Intergenic
1017522325 6:155213400-155213422 CTGCTTAGCTTTAAGCAGAGAGG + Intronic
1018343397 6:162876320-162876342 CTGCTGTCCTCTAATAATACAGG + Intronic
1018967652 6:168501058-168501080 CTTCTGACCCCTAAGAATCGTGG + Intronic
1020187198 7:5968414-5968436 ATGCTGACCTATAAGGAGAGGGG - Intronic
1020295719 7:6756358-6756380 ATGCTGACCTATAAGGAGAGGGG + Intronic
1023850457 7:44147133-44147155 CTACTGACCTATAATAATAGAGG + Intronic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1029799430 7:102930696-102930718 ATGCTGACTTTTAGGAACAGAGG - Intronic
1031172159 7:118305726-118305748 CTGCTGAATTTAAGGAATAGGGG + Intergenic
1031957437 7:127956643-127956665 CTGCTGAGTTCTAAGAACAGGGG + Intronic
1032143354 7:129354851-129354873 CTCATGACCTTTAAAATTAGAGG + Intronic
1032183072 7:129698416-129698438 CTAGGCACCTTTAAGAATAGTGG + Intronic
1033460280 7:141541109-141541131 CAGCTGTCCTTATAGAATAGTGG + Intergenic
1034115131 7:148577610-148577632 CTCCTGACCTGGAAGAATATTGG - Intergenic
1034115811 7:148582844-148582866 CTGCTGACCTTGAACACAAGAGG - Intergenic
1041620745 8:59965366-59965388 CTACTGACTTCTAGGAATAGAGG - Intergenic
1041930150 8:63277593-63277615 CCCCTGAGCTTTAAGAATGGAGG + Intergenic
1043784451 8:84380491-84380513 CTCCTGGCCTATAAGAATAATGG + Intronic
1050228004 9:3483674-3483696 TTGCTGATCTTTACTAATAGAGG - Intronic
1060621089 9:125067369-125067391 CTGCTGTCCTTAAAGAGCAGAGG + Intronic
1062250459 9:135591315-135591337 CTGGGGACCCTTAAGAACAGAGG - Intergenic
1190039851 X:47061944-47061966 TTGCTGACCTTTCAGAATTGAGG + Intergenic
1190357185 X:49616898-49616920 CTGCTGACCTTCAACAACAGAGG - Intergenic
1191037648 X:56044374-56044396 CTGCTGGCTTTGAAGAATACAGG - Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1192277438 X:69648262-69648284 CTGCTGGCTGTTAAGAATACAGG - Intronic
1195006536 X:100690839-100690861 CTGCTGTCCCTTAAGAATGAGGG - Intronic
1197114707 X:122818419-122818441 CTGCTGGCTTTGAAGAATATAGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198806187 X:140497654-140497676 CTGTTGACCTTTCAGAAAAGAGG - Intergenic
1199976713 X:152898567-152898589 CTGCAGGCCTTTAAGAATCAGGG + Intergenic
1200145598 X:153924882-153924904 ATGCTGACCTTTGAGAATTTAGG + Intronic